Incidental Mutation 'R8477:Cyp2c55'
ID 657341
Institutional Source Beutler Lab
Gene Symbol Cyp2c55
Ensembl Gene ENSMUSG00000025002
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 55
Synonyms 2010318C06Rik
MMRRC Submission 067921-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R8477 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 38995463-39031137 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 38999485 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 64 (V64L)
Ref Sequence ENSEMBL: ENSMUSP00000025966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025966]
AlphaFold Q9D816
Predicted Effect probably damaging
Transcript: ENSMUST00000025966
AA Change: V64L

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025966
Gene: ENSMUSG00000025002
AA Change: V64L

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:p450 30 487 1.1e-154 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum but its specific substrate has not yet been determined. The gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. An additional gene, CYP2C17, was once thought to exist; however, CYP2C17 is now considered an artefact based on a chimera of CYP2C18 and CYP2C19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 78,924,174 (GRCm39) S94L probably benign Het
Ackr1 C T 1: 173,159,755 (GRCm39) G255R probably damaging Het
Aldh1l2 G A 10: 83,337,785 (GRCm39) T560I probably damaging Het
Arhgef25 A T 10: 127,020,266 (GRCm39) F384I probably damaging Het
Bptf T A 11: 106,943,679 (GRCm39) Q2671L probably damaging Het
Ccdc159 A G 9: 21,844,223 (GRCm39) E95G probably damaging Het
Cenpf A T 1: 189,385,385 (GRCm39) H2298Q probably benign Het
Chn2 G T 6: 54,246,467 (GRCm39) probably null Het
Csnk1g1 T C 9: 65,909,555 (GRCm39) L224P probably damaging Het
Cyp2c54 T A 19: 40,058,708 (GRCm39) K241N probably benign Het
Dlgap1 A C 17: 70,823,967 (GRCm39) Q317H probably damaging Het
Dnaja3 A G 16: 4,505,212 (GRCm39) D108G probably null Het
Dpagt1 G T 9: 44,243,390 (GRCm39) probably null Het
Dzip1 T C 14: 119,138,958 (GRCm39) R424G possibly damaging Het
Ero1b A G 13: 12,616,672 (GRCm39) K367R probably benign Het
Evi2 T C 11: 79,406,891 (GRCm39) Y228C probably benign Het
Exosc10 A T 4: 148,649,847 (GRCm39) I426L possibly damaging Het
Gba2 C T 4: 43,569,944 (GRCm39) R423Q probably damaging Het
Gm19965 A C 1: 116,730,854 (GRCm39) probably benign Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
Gvin2 T C 7: 105,548,133 (GRCm39) K1640E possibly damaging Het
Hc A T 2: 34,879,182 (GRCm39) C1557S probably damaging Het
Hfm1 C T 5: 107,029,684 (GRCm39) S799N probably benign Het
Hibadh A T 6: 52,617,185 (GRCm39) W17R probably benign Het
Hivep1 A T 13: 42,337,696 (GRCm39) T2592S probably benign Het
Ighv8-5 G A 12: 115,031,200 (GRCm39) T113I probably benign Het
Il2rb A T 15: 78,370,006 (GRCm39) V211D probably damaging Het
Itgal A G 7: 126,900,105 (GRCm39) Y121C probably damaging Het
Kirrel1 T C 3: 86,992,138 (GRCm39) T597A possibly damaging Het
Lats1 A G 10: 7,581,279 (GRCm39) E688G probably damaging Het
Lbr C T 1: 181,644,539 (GRCm39) A589T possibly damaging Het
Limch1 G A 5: 67,131,908 (GRCm39) V133I probably benign Het
Mast2 C T 4: 116,164,407 (GRCm39) A1670T probably benign Het
Mtcl1 A T 17: 66,684,942 (GRCm39) L949Q probably benign Het
Nlrp4a T C 7: 26,159,219 (GRCm39) V833A probably benign Het
Or12k5 T C 2: 36,895,060 (GRCm39) T189A probably benign Het
Or8g28 A T 9: 39,169,099 (GRCm39) Y290N probably damaging Het
Osgep C A 14: 51,155,334 (GRCm39) A75S probably damaging Het
Pank1 C A 19: 34,856,055 (GRCm39) R141L probably benign Het
Pcdhb20 T A 18: 37,638,307 (GRCm39) S278T probably benign Het
Pcdhgb8 C A 18: 37,896,365 (GRCm39) F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 (GRCm39) probably benign Het
Polr2a G A 11: 69,626,312 (GRCm39) P1613S probably benign Het
Pramel55 A C 5: 95,949,567 (GRCm39) M105L probably benign Het
Prom2 A C 2: 127,381,124 (GRCm39) S251A probably benign Het
R3hdm2 A G 10: 127,320,029 (GRCm39) H546R probably damaging Het
Reck G T 4: 43,891,011 (GRCm39) V50L probably benign Het
Rerg T C 6: 137,033,184 (GRCm39) T164A probably benign Het
Rho T A 6: 115,912,346 (GRCm39) probably null Het
Ric1 A G 19: 29,575,183 (GRCm39) T959A probably damaging Het
Slc28a3 T A 13: 58,724,609 (GRCm39) N215I possibly damaging Het
Slc2a5 G A 4: 150,210,119 (GRCm39) V35I probably benign Het
Srpk2 A T 5: 23,718,986 (GRCm39) S610T probably benign Het
Tasor2 A G 13: 3,625,079 (GRCm39) F1624L probably benign Het
Tmem147 T A 7: 30,427,656 (GRCm39) M86L probably benign Het
Trhde A G 10: 114,636,622 (GRCm39) V195A probably benign Het
Trio T C 15: 27,774,038 (GRCm39) S112G possibly damaging Het
U2af2 T C 7: 5,078,693 (GRCm39) V424A probably benign Het
Vmn2r27 T C 6: 124,201,200 (GRCm39) I252M probably benign Het
Wasf2 A G 4: 132,912,412 (GRCm39) E88G unknown Het
Zfp37 A G 4: 62,110,240 (GRCm39) C275R probably damaging Het
Zfp532 A T 18: 65,757,137 (GRCm39) I357F probably damaging Het
Other mutations in Cyp2c55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Cyp2c55 APN 19 39,000,190 (GRCm39) missense probably benign 0.41
IGL00537:Cyp2c55 APN 19 39,000,150 (GRCm39) missense possibly damaging 0.93
IGL00959:Cyp2c55 APN 19 39,026,587 (GRCm39) missense probably benign 0.00
IGL01140:Cyp2c55 APN 19 39,007,093 (GRCm39) missense probably benign
IGL01792:Cyp2c55 APN 19 39,030,631 (GRCm39) missense probably benign
PIT4453001:Cyp2c55 UTSW 19 39,000,235 (GRCm39) missense probably damaging 1.00
R0472:Cyp2c55 UTSW 19 39,019,823 (GRCm39) missense probably benign 0.01
R1452:Cyp2c55 UTSW 19 38,999,534 (GRCm39) missense probably damaging 1.00
R1468:Cyp2c55 UTSW 19 38,999,525 (GRCm39) missense probably damaging 0.96
R1468:Cyp2c55 UTSW 19 38,999,525 (GRCm39) missense probably damaging 0.96
R1925:Cyp2c55 UTSW 19 39,022,821 (GRCm39) missense probably benign 0.06
R2154:Cyp2c55 UTSW 19 39,022,819 (GRCm39) missense probably damaging 1.00
R3814:Cyp2c55 UTSW 19 38,995,509 (GRCm39) missense probably damaging 1.00
R4021:Cyp2c55 UTSW 19 39,023,878 (GRCm39) splice site probably null
R4022:Cyp2c55 UTSW 19 39,023,878 (GRCm39) splice site probably null
R4293:Cyp2c55 UTSW 19 39,000,235 (GRCm39) missense probably damaging 1.00
R4294:Cyp2c55 UTSW 19 39,000,235 (GRCm39) missense probably damaging 1.00
R4604:Cyp2c55 UTSW 19 39,019,830 (GRCm39) missense possibly damaging 0.82
R4740:Cyp2c55 UTSW 19 39,007,173 (GRCm39) missense probably benign
R4756:Cyp2c55 UTSW 19 39,019,815 (GRCm39) missense probably damaging 1.00
R4879:Cyp2c55 UTSW 19 39,030,522 (GRCm39) frame shift probably null
R5039:Cyp2c55 UTSW 19 39,026,587 (GRCm39) missense probably benign 0.00
R5672:Cyp2c55 UTSW 19 39,023,990 (GRCm39) missense probably benign 0.02
R5834:Cyp2c55 UTSW 19 39,030,511 (GRCm39) missense probably benign 0.00
R6198:Cyp2c55 UTSW 19 38,995,565 (GRCm39) nonsense probably null
R6255:Cyp2c55 UTSW 19 39,007,111 (GRCm39) missense probably benign 0.25
R6431:Cyp2c55 UTSW 19 39,019,853 (GRCm39) missense probably damaging 0.99
R6565:Cyp2c55 UTSW 19 39,030,566 (GRCm39) missense probably benign 0.09
R7934:Cyp2c55 UTSW 19 39,030,535 (GRCm39) missense probably damaging 1.00
R8865:Cyp2c55 UTSW 19 39,019,878 (GRCm39) missense probably benign 0.21
R8904:Cyp2c55 UTSW 19 39,022,816 (GRCm39) missense
R8960:Cyp2c55 UTSW 19 38,995,547 (GRCm39) missense probably null 1.00
R9012:Cyp2c55 UTSW 19 39,030,560 (GRCm39) missense probably benign 0.00
R9037:Cyp2c55 UTSW 19 39,030,537 (GRCm39) missense probably damaging 1.00
R9047:Cyp2c55 UTSW 19 39,019,790 (GRCm39) missense possibly damaging 0.55
R9164:Cyp2c55 UTSW 19 38,995,571 (GRCm39) nonsense probably null
X0062:Cyp2c55 UTSW 19 39,007,133 (GRCm39) missense probably damaging 0.98
Z1176:Cyp2c55 UTSW 19 39,023,957 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTGCACATTGGTTTGTCTGGAAATC -3'
(R):5'- CCCTATGATCCATGCTCAGC -3'

Sequencing Primer
(F):5'- CTGGTAAACAAGATACATGCTGC -3'
(R):5'- GCTCAGCATACACATGCAT -3'
Posted On 2021-01-18