Incidental Mutation 'R8478:Als2'
ID657345
Institutional Source Beutler Lab
Gene Symbol Als2
Ensembl Gene ENSMUSG00000026024
Gene Namealsin Rho guanine nucleotide exchange factor
Synonyms3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.798) question?
Stock #R8478 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location59162926-59237231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59186016 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 986 (E986G)
Ref Sequence ENSEMBL: ENSMUSP00000125753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027178] [ENSMUST00000163058]
Predicted Effect probably damaging
Transcript: ENSMUST00000027178
AA Change: E986G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027178
Gene: ENSMUSG00000026024
AA Change: E986G

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 1.1e-9 PFAM
Pfam:RCC1 109 165 9.5e-11 PFAM
Pfam:RCC1 170 216 6.6e-11 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 5.4e-13 PFAM
Pfam:RCC1_2 555 584 8.3e-12 PFAM
Pfam:RCC1 571 619 3.4e-11 PFAM
Pfam:RhoGEF 688 877 6.5e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 8.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163058
AA Change: E986G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125753
Gene: ENSMUSG00000026024
AA Change: E986G

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 9.9e-10 PFAM
Pfam:RCC1 109 165 9.5e-12 PFAM
Pfam:RCC1 170 216 4.9e-12 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 4.6e-14 PFAM
Pfam:RCC1_2 555 584 1.2e-11 PFAM
Pfam:RCC1 571 619 8.6e-11 PFAM
Pfam:RhoGEF 688 877 2.6e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 1e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mutations in this gene may result in increased body weight, altered endosome trafficking, modest motor behavioral abnormalities, altered anxiety responses, impaired axonal transport, and mild neurolopathogical deficits including axonal degeneration in the corticospinal tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,033,277 D511V possibly damaging Het
Actl11 A T 9: 107,928,645 I56F possibly damaging Het
Adgrl3 G T 5: 81,794,501 R1357L possibly damaging Het
Alpk1 T A 3: 127,729,312 D27V probably damaging Het
Ankle2 T A 5: 110,252,952 L717Q possibly damaging Het
Arl8b A G 6: 108,783,324 T24A possibly damaging Het
Atp2a1 A G 7: 126,448,330 I718T probably damaging Het
Atp6v0e2 T A 6: 48,540,097 N70K probably benign Het
Bcl11a A G 11: 24,165,086 S810G probably damaging Het
Bcl2a1d T G 9: 88,723,435 *173S probably null Het
Cacna1g A G 11: 94,426,452 Y1494H probably damaging Het
Ccdc7a T C 8: 128,761,369 K186E possibly damaging Het
Cfap43 T C 19: 47,776,076 I817V probably benign Het
Chd5 C T 4: 152,356,690 R196* probably null Het
Chsy1 C T 7: 66,171,000 H328Y probably benign Het
Clcn3 A T 8: 60,919,488 S713T probably benign Het
Csrnp3 A T 2: 65,878,056 probably null Het
Dnhd1 A G 7: 105,682,794 N86S probably benign Het
Epha3 T C 16: 63,773,081 T215A probably damaging Het
Fam129a C A 1: 151,636,512 T55K possibly damaging Het
Fgf1 T C 18: 38,854,891 probably null Het
Fosl1 T C 19: 5,454,919 S145P probably damaging Het
Frem3 T A 8: 80,611,558 V160E probably damaging Het
Galk2 A T 2: 125,929,585 K177* probably null Het
Gm35339 T C 15: 76,363,429 probably null Het
Gria1 T C 11: 57,309,842 Y782H probably damaging Het
Gria4 C T 9: 4,793,882 E59K probably damaging Het
Ighv1-11 A G 12: 114,612,299 Y99H possibly damaging Het
Insm2 A T 12: 55,600,545 Y358F probably damaging Het
Marveld3 C T 8: 109,961,968 G47D probably damaging Het
Mthfd1l A G 10: 4,148,064 D967G probably damaging Het
Nav2 G T 7: 49,461,985 M746I probably damaging Het
Nmnat1 A G 4: 149,473,384 I67T possibly damaging Het
Nub1 G T 5: 24,701,424 R316L probably benign Het
Nxn A G 11: 76,274,043 V214A probably damaging Het
Olfr669 C A 7: 104,939,270 S248Y probably benign Het
Pelp1 A T 11: 70,394,320 D907E unknown Het
Pik3c2a A T 7: 116,418,349 S58T probably damaging Het
Pik3ca A G 3: 32,451,848 N703S probably benign Het
Polr3c G A 3: 96,716,750 probably benign Het
Pon1 C T 6: 5,185,318 G61R probably damaging Het
Pou2f1 A T 1: 165,931,718 M1K probably null Het
Prkdc T A 16: 15,648,924 C90S probably benign Het
Prokr1 A G 6: 87,581,348 Y352H probably benign Het
Rhod C T 19: 4,426,691 R134H probably damaging Het
Rufy3 C T 5: 88,615,036 R110W probably damaging Het
Sema4c A T 1: 36,551,790 M460K probably benign Het
Slc46a3 T C 5: 147,879,153 S455G probably benign Het
Smyd1 A T 6: 71,216,827 H371Q probably damaging Het
Steap1 A G 5: 5,736,432 M335T probably benign Het
Suox A G 10: 128,671,052 V369A probably damaging Het
Thbs2 T C 17: 14,680,404 I514V probably benign Het
Tie1 A T 4: 118,484,782 probably null Het
Tmem131l T C 3: 83,898,462 E1558G probably damaging Het
Tpcn1 G T 5: 120,560,321 H45Q probably benign Het
Ush1c A G 7: 46,221,433 S327P probably damaging Het
Ush2a G A 1: 188,443,232 V1176M possibly damaging Het
Utrn A G 10: 12,649,148 M2197T probably benign Het
Vmn1r50 G T 6: 90,108,089 C272F probably benign Het
Vmn2r10 A T 5: 108,995,770 N771K probably damaging Het
Vmn2r2 A T 3: 64,116,836 F691I possibly damaging Het
Vmn2r53 T C 7: 12,606,354 Q64R probably benign Het
Vmn2r95 G T 17: 18,452,282 L760F probably damaging Het
Xdh C A 17: 73,906,058 E863D probably benign Het
Ykt6 A G 11: 5,962,407 Y120C possibly damaging Het
Zranb2 A G 3: 157,546,108 *321W probably null Het
Other mutations in Als2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Als2 APN 1 59169896 nonsense probably null
IGL00924:Als2 APN 1 59215862 missense probably benign 0.03
IGL00949:Als2 APN 1 59215572 missense probably damaging 1.00
IGL00950:Als2 APN 1 59215382 missense probably benign 0.01
IGL01090:Als2 APN 1 59215616 missense possibly damaging 0.81
IGL01116:Als2 APN 1 59186004 splice site probably benign
IGL02001:Als2 APN 1 59180188 splice site probably benign
IGL02075:Als2 APN 1 59207786 missense probably damaging 1.00
IGL02441:Als2 APN 1 59215472 missense probably damaging 0.98
IGL02728:Als2 APN 1 59196347 missense probably benign 0.00
IGL02740:Als2 APN 1 59169919 missense probably benign 0.01
IGL02885:Als2 APN 1 59167491 missense probably benign 0.30
IGL02896:Als2 APN 1 59183787 missense probably benign 0.17
IGL02978:Als2 APN 1 59215165 missense probably benign 0.32
IGL03032:Als2 APN 1 59216030 splice site probably benign
IGL03065:Als2 APN 1 59215872 missense probably benign
IGL03212:Als2 APN 1 59202926 missense probably benign 0.00
IGL03226:Als2 APN 1 59186520 missense probably benign 0.43
R0014:Als2 UTSW 1 59211388 missense possibly damaging 0.53
R0243:Als2 UTSW 1 59215387 missense probably benign
R0326:Als2 UTSW 1 59180583 missense probably damaging 1.00
R0376:Als2 UTSW 1 59215565 missense probably benign 0.00
R0605:Als2 UTSW 1 59168414 missense probably benign 0.02
R1607:Als2 UTSW 1 59180147 missense probably damaging 1.00
R1631:Als2 UTSW 1 59218067 missense probably benign 0.00
R1657:Als2 UTSW 1 59180601 missense probably damaging 1.00
R1763:Als2 UTSW 1 59174991 missense probably benign
R1950:Als2 UTSW 1 59185601 critical splice acceptor site probably null
R1970:Als2 UTSW 1 59215169 missense probably benign 0.34
R2151:Als2 UTSW 1 59207789 missense probably damaging 1.00
R2292:Als2 UTSW 1 59187385 missense probably damaging 1.00
R2513:Als2 UTSW 1 59215117 missense probably benign 0.00
R2849:Als2 UTSW 1 59206538 missense probably damaging 0.97
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2873:Als2 UTSW 1 59211137 missense probably damaging 1.00
R3054:Als2 UTSW 1 59215494 missense probably damaging 1.00
R3081:Als2 UTSW 1 59187349 missense probably damaging 1.00
R3176:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3276:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3801:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3803:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3808:Als2 UTSW 1 59170450 missense probably benign 0.08
R3884:Als2 UTSW 1 59185568 missense probably damaging 0.99
R4012:Als2 UTSW 1 59187416 missense probably benign 0.09
R4033:Als2 UTSW 1 59196241 missense probably benign
R4201:Als2 UTSW 1 59180154 missense possibly damaging 0.77
R4321:Als2 UTSW 1 59167454 splice site probably benign
R4707:Als2 UTSW 1 59215313 missense probably benign
R4784:Als2 UTSW 1 59215313 missense probably benign
R4785:Als2 UTSW 1 59215313 missense probably benign
R4991:Als2 UTSW 1 59207768 missense probably benign 0.10
R5068:Als2 UTSW 1 59211274 missense probably benign 0.13
R5110:Als2 UTSW 1 59185441 missense probably damaging 0.98
R5141:Als2 UTSW 1 59170452 missense possibly damaging 0.80
R5394:Als2 UTSW 1 59174946 missense probably benign 0.06
R5621:Als2 UTSW 1 59191890 missense probably benign 0.33
R5685:Als2 UTSW 1 59179091 missense possibly damaging 0.73
R5987:Als2 UTSW 1 59206587 missense probably damaging 1.00
R6012:Als2 UTSW 1 59185215 missense probably damaging 1.00
R6118:Als2 UTSW 1 59203069 missense possibly damaging 0.62
R6222:Als2 UTSW 1 59180125 missense probably benign 0.04
R6367:Als2 UTSW 1 59199140 missense probably benign 0.04
R6394:Als2 UTSW 1 59167197 missense probably damaging 0.99
R6866:Als2 UTSW 1 59211133 missense probably damaging 1.00
R6965:Als2 UTSW 1 59170557 missense possibly damaging 0.70
R7038:Als2 UTSW 1 59167514 missense possibly damaging 0.94
R7178:Als2 UTSW 1 59207812 missense probably damaging 0.96
R7494:Als2 UTSW 1 59183166 splice site probably null
R7541:Als2 UTSW 1 59167616 splice site probably null
R7601:Als2 UTSW 1 59170002 missense probably benign 0.17
R8380:Als2 UTSW 1 59211308 missense probably benign
R8492:Als2 UTSW 1 59211344 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCAGTAAGGACAATCGGGCATC -3'
(R):5'- TGGAGCTCAGATTACAGCATG -3'

Sequencing Primer
(F):5'- ACAATCGGGCATCCTGGAGTATTC -3'
(R):5'- GCATGAACCCTTAAGCTACTTC -3'
Posted On2021-01-18