Incidental Mutation 'R8478:Tpcn1'
ID657364
Institutional Source Beutler Lab
Gene Symbol Tpcn1
Ensembl Gene ENSMUSG00000032741
Gene Nametwo pore channel 1
Synonyms5730403B01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8478 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location120534153-120588673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 120560321 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 45 (H45Q)
Ref Sequence ENSEMBL: ENSMUSP00000042188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046426]
Predicted Effect probably benign
Transcript: ENSMUST00000046426
AA Change: H45Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042188
Gene: ENSMUSG00000032741
AA Change: H45Q

DomainStartEndE-ValueType
Pfam:Ion_trans 106 332 1.5e-30 PFAM
Pfam:Ion_trans 441 695 1.2e-31 PFAM
SCOP:d1fxkc_ 713 795 2e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated Ca(2+) and Na+ channels have 4 homologous domains, each containing 6 transmembrane segments, S1 to S6. TPCN1 is similar to these channels, but it has only 2 domains containing S1 to S6 (Ishibashi et al., 2000 [PubMed 10753632]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene results in no apparent phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,033,277 D511V possibly damaging Het
Actl11 A T 9: 107,928,645 I56F possibly damaging Het
Adgrl3 G T 5: 81,794,501 R1357L possibly damaging Het
Alpk1 T A 3: 127,729,312 D27V probably damaging Het
Als2 T C 1: 59,186,016 E986G probably damaging Het
Ankle2 T A 5: 110,252,952 L717Q possibly damaging Het
Arl8b A G 6: 108,783,324 T24A possibly damaging Het
Atp2a1 A G 7: 126,448,330 I718T probably damaging Het
Atp6v0e2 T A 6: 48,540,097 N70K probably benign Het
Bcl11a A G 11: 24,165,086 S810G probably damaging Het
Bcl2a1d T G 9: 88,723,435 *173S probably null Het
Cacna1g A G 11: 94,426,452 Y1494H probably damaging Het
Ccdc7a T C 8: 128,761,369 K186E possibly damaging Het
Cfap43 T C 19: 47,776,076 I817V probably benign Het
Chd5 C T 4: 152,356,690 R196* probably null Het
Chsy1 C T 7: 66,171,000 H328Y probably benign Het
Clcn3 A T 8: 60,919,488 S713T probably benign Het
Csrnp3 A T 2: 65,878,056 probably null Het
Dnhd1 A G 7: 105,682,794 N86S probably benign Het
Epha3 T C 16: 63,773,081 T215A probably damaging Het
Fam129a C A 1: 151,636,512 T55K possibly damaging Het
Fgf1 T C 18: 38,854,891 probably null Het
Fosl1 T C 19: 5,454,919 S145P probably damaging Het
Frem3 T A 8: 80,611,558 V160E probably damaging Het
Galk2 A T 2: 125,929,585 K177* probably null Het
Gm35339 T C 15: 76,363,429 probably null Het
Gria1 T C 11: 57,309,842 Y782H probably damaging Het
Gria4 C T 9: 4,793,882 E59K probably damaging Het
Ighv1-11 A G 12: 114,612,299 Y99H possibly damaging Het
Insm2 A T 12: 55,600,545 Y358F probably damaging Het
Marveld3 C T 8: 109,961,968 G47D probably damaging Het
Mthfd1l A G 10: 4,148,064 D967G probably damaging Het
Nav2 G T 7: 49,461,985 M746I probably damaging Het
Nmnat1 A G 4: 149,473,384 I67T possibly damaging Het
Nub1 G T 5: 24,701,424 R316L probably benign Het
Nxn A G 11: 76,274,043 V214A probably damaging Het
Olfr669 C A 7: 104,939,270 S248Y probably benign Het
Pelp1 A T 11: 70,394,320 D907E unknown Het
Pik3c2a A T 7: 116,418,349 S58T probably damaging Het
Pik3ca A G 3: 32,451,848 N703S probably benign Het
Polr3c G A 3: 96,716,750 probably benign Het
Pon1 C T 6: 5,185,318 G61R probably damaging Het
Pou2f1 A T 1: 165,931,718 M1K probably null Het
Prkdc T A 16: 15,648,924 C90S probably benign Het
Prokr1 A G 6: 87,581,348 Y352H probably benign Het
Rhod C T 19: 4,426,691 R134H probably damaging Het
Rufy3 C T 5: 88,615,036 R110W probably damaging Het
Sema4c A T 1: 36,551,790 M460K probably benign Het
Slc46a3 T C 5: 147,879,153 S455G probably benign Het
Smyd1 A T 6: 71,216,827 H371Q probably damaging Het
Steap1 A G 5: 5,736,432 M335T probably benign Het
Suox A G 10: 128,671,052 V369A probably damaging Het
Thbs2 T C 17: 14,680,404 I514V probably benign Het
Tie1 A T 4: 118,484,782 probably null Het
Tmem131l T C 3: 83,898,462 E1558G probably damaging Het
Ush1c A G 7: 46,221,433 S327P probably damaging Het
Ush2a G A 1: 188,443,232 V1176M possibly damaging Het
Utrn A G 10: 12,649,148 M2197T probably benign Het
Vmn1r50 G T 6: 90,108,089 C272F probably benign Het
Vmn2r10 A T 5: 108,995,770 N771K probably damaging Het
Vmn2r2 A T 3: 64,116,836 F691I possibly damaging Het
Vmn2r53 T C 7: 12,606,354 Q64R probably benign Het
Vmn2r95 G T 17: 18,452,282 L760F probably damaging Het
Xdh C A 17: 73,906,058 E863D probably benign Het
Ykt6 A G 11: 5,962,407 Y120C possibly damaging Het
Zranb2 A G 3: 157,546,108 *321W probably null Het
Other mutations in Tpcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Tpcn1 APN 5 120545305 missense probably damaging 0.99
IGL00551:Tpcn1 APN 5 120560325 missense probably benign 0.31
IGL02197:Tpcn1 APN 5 120553531 missense probably damaging 1.00
IGL02584:Tpcn1 APN 5 120539032 missense probably damaging 0.99
IGL03064:Tpcn1 APN 5 120537566 missense possibly damaging 0.90
PIT1430001:Tpcn1 UTSW 5 120548323 splice site probably benign
R0295:Tpcn1 UTSW 5 120539060 missense probably damaging 1.00
R0316:Tpcn1 UTSW 5 120539259 missense probably damaging 1.00
R1577:Tpcn1 UTSW 5 120544420 missense probably damaging 1.00
R1660:Tpcn1 UTSW 5 120549515 missense possibly damaging 0.82
R1819:Tpcn1 UTSW 5 120536227 splice site probably null
R2051:Tpcn1 UTSW 5 120543388 missense probably damaging 1.00
R2364:Tpcn1 UTSW 5 120553494 nonsense probably null
R2497:Tpcn1 UTSW 5 120538998 splice site probably null
R3965:Tpcn1 UTSW 5 120556575 missense probably damaging 0.98
R3972:Tpcn1 UTSW 5 120553752 critical splice donor site probably null
R4062:Tpcn1 UTSW 5 120557897 missense possibly damaging 0.82
R4343:Tpcn1 UTSW 5 120560220 missense probably damaging 1.00
R4422:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4423:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4424:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4655:Tpcn1 UTSW 5 120539257 missense probably damaging 0.98
R4831:Tpcn1 UTSW 5 120553489 missense probably damaging 1.00
R4910:Tpcn1 UTSW 5 120556519 missense probably damaging 0.98
R4948:Tpcn1 UTSW 5 120556531 missense probably benign 0.15
R4965:Tpcn1 UTSW 5 120547487 missense possibly damaging 0.82
R4976:Tpcn1 UTSW 5 120560322 missense probably benign
R5071:Tpcn1 UTSW 5 120548269 critical splice donor site probably null
R5165:Tpcn1 UTSW 5 120557945 missense probably damaging 1.00
R5210:Tpcn1 UTSW 5 120539214 missense probably damaging 1.00
R5910:Tpcn1 UTSW 5 120547397 intron probably benign
R5939:Tpcn1 UTSW 5 120539827 missense probably damaging 1.00
R6364:Tpcn1 UTSW 5 120553810 missense probably damaging 1.00
R6633:Tpcn1 UTSW 5 120544464 missense probably benign 0.03
R6650:Tpcn1 UTSW 5 120537562 missense probably null 0.50
R6885:Tpcn1 UTSW 5 120544437 missense probably benign 0.21
R7038:Tpcn1 UTSW 5 120585277 missense probably damaging 0.99
R7247:Tpcn1 UTSW 5 120585250 missense possibly damaging 0.63
R7594:Tpcn1 UTSW 5 120556530 missense possibly damaging 0.67
R7629:Tpcn1 UTSW 5 120537937 missense probably benign 0.00
R7854:Tpcn1 UTSW 5 120549588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGAGCTGCTGTGCTAAG -3'
(R):5'- TTGGCACATGGACAGACTGAC -3'

Sequencing Primer
(F):5'- TGCTAAGCACGCCCCTC -3'
(R):5'- ACCGGCAGCAGAAGACCTTG -3'
Posted On2021-01-18