Incidental Mutation 'R8478:Chsy1'
ID657375
Institutional Source Beutler Lab
Gene Symbol Chsy1
Ensembl Gene ENSMUSG00000032640
Gene Namechondroitin sulfate synthase 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8478 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location66109515-66173798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66171000 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 328 (H328Y)
Ref Sequence ENSEMBL: ENSMUSP00000047487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036372]
Predicted Effect probably benign
Transcript: ENSMUST00000036372
AA Change: H328Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047487
Gene: ENSMUSG00000032640
AA Change: H328Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Fringe 81 307 3.8e-21 PFAM
Pfam:CHGN 237 776 9.8e-197 PFAM
Pfam:Glyco_tranf_2_2 548 751 1.2e-10 PFAM
Pfam:Glyco_transf_7C 674 747 2.5e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chondroitin N-acetylgalactosaminyltransferase family. These enzymes possess dual glucuronyltransferase and galactosaminyltransferase activity and play critical roles in the biosynthesis of chondroitin sulfate, a glycosaminoglycan involved in many biological processes including cell proliferation and morphogenesis. Decreased expression of this gene may play a role in colorectal cancer, and mutations in this gene are a cause of temtamy preaxial brachydactyly syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mice are viable, but display chondrodysplasia, brachydactyly and decreased bone density. Retinal degeneration, impaired motor strength, and hematological abnormalities are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,033,277 D511V possibly damaging Het
Actl11 A T 9: 107,928,645 I56F possibly damaging Het
Adgrl3 G T 5: 81,794,501 R1357L possibly damaging Het
Alpk1 T A 3: 127,729,312 D27V probably damaging Het
Als2 T C 1: 59,186,016 E986G probably damaging Het
Ankle2 T A 5: 110,252,952 L717Q possibly damaging Het
Arl8b A G 6: 108,783,324 T24A possibly damaging Het
Atp2a1 A G 7: 126,448,330 I718T probably damaging Het
Atp6v0e2 T A 6: 48,540,097 N70K probably benign Het
Bcl11a A G 11: 24,165,086 S810G probably damaging Het
Bcl2a1d T G 9: 88,723,435 *173S probably null Het
Cacna1g A G 11: 94,426,452 Y1494H probably damaging Het
Ccdc7a T C 8: 128,761,369 K186E possibly damaging Het
Cfap43 T C 19: 47,776,076 I817V probably benign Het
Chd5 C T 4: 152,356,690 R196* probably null Het
Clcn3 A T 8: 60,919,488 S713T probably benign Het
Dnhd1 A G 7: 105,682,794 N86S probably benign Het
Epha3 T C 16: 63,773,081 T215A probably damaging Het
Fam129a C A 1: 151,636,512 T55K possibly damaging Het
Fosl1 T C 19: 5,454,919 S145P probably damaging Het
Frem3 T A 8: 80,611,558 V160E probably damaging Het
Galk2 A T 2: 125,929,585 K177* probably null Het
Gria1 T C 11: 57,309,842 Y782H probably damaging Het
Gria4 C T 9: 4,793,882 E59K probably damaging Het
Ighv1-11 A G 12: 114,612,299 Y99H possibly damaging Het
Insm2 A T 12: 55,600,545 Y358F probably damaging Het
Marveld3 C T 8: 109,961,968 G47D probably damaging Het
Mthfd1l A G 10: 4,148,064 D967G probably damaging Het
Nav2 G T 7: 49,461,985 M746I probably damaging Het
Nmnat1 A G 4: 149,473,384 I67T possibly damaging Het
Nub1 G T 5: 24,701,424 R316L probably benign Het
Nxn A G 11: 76,274,043 V214A probably damaging Het
Olfr669 C A 7: 104,939,270 S248Y probably benign Het
Pelp1 A T 11: 70,394,320 D907E unknown Het
Pik3c2a A T 7: 116,418,349 S58T probably damaging Het
Pik3ca A G 3: 32,451,848 N703S probably benign Het
Pon1 C T 6: 5,185,318 G61R probably damaging Het
Pou2f1 A T 1: 165,931,718 M1K probably null Het
Prkdc T A 16: 15,648,924 C90S probably benign Het
Prokr1 A G 6: 87,581,348 Y352H probably benign Het
Rhod C T 19: 4,426,691 R134H probably damaging Het
Rufy3 C T 5: 88,615,036 R110W probably damaging Het
Sema4c A T 1: 36,551,790 M460K probably benign Het
Slc46a3 T C 5: 147,879,153 S455G probably benign Het
Smyd1 A T 6: 71,216,827 H371Q probably damaging Het
Steap1 A G 5: 5,736,432 M335T probably benign Het
Suox A G 10: 128,671,052 V369A probably damaging Het
Thbs2 T C 17: 14,680,404 I514V probably benign Het
Tmem131l T C 3: 83,898,462 E1558G probably damaging Het
Tpcn1 G T 5: 120,560,321 H45Q probably benign Het
Ush1c A G 7: 46,221,433 S327P probably damaging Het
Ush2a G A 1: 188,443,232 V1176M possibly damaging Het
Utrn A G 10: 12,649,148 M2197T probably benign Het
Vmn1r50 G T 6: 90,108,089 C272F probably benign Het
Vmn2r10 A T 5: 108,995,770 N771K probably damaging Het
Vmn2r2 A T 3: 64,116,836 F691I possibly damaging Het
Vmn2r53 T C 7: 12,606,354 Q64R probably benign Het
Vmn2r95 G T 17: 18,452,282 L760F probably damaging Het
Xdh C A 17: 73,906,058 E863D probably benign Het
Ykt6 A G 11: 5,962,407 Y120C possibly damaging Het
Zranb2 A G 3: 157,546,108 *321W probably null Het
Other mutations in Chsy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Chsy1 APN 7 66172126 missense possibly damaging 0.70
IGL01734:Chsy1 APN 7 66171310 missense probably damaging 0.98
IGL02037:Chsy1 APN 7 66171828 missense possibly damaging 0.69
IGL02797:Chsy1 APN 7 66171664 missense probably damaging 1.00
IGL02961:Chsy1 APN 7 66171782 missense probably benign 0.00
IGL03290:Chsy1 APN 7 66171031 missense probably benign 0.15
IGL03292:Chsy1 APN 7 66125372 missense probably benign 0.02
Chrysanthemum UTSW 7 66110229 critical splice donor site probably null
coesite UTSW 7 66125463 missense probably damaging 1.00
deprimido UTSW 7 66171687 missense probably damaging 1.00
Elevado UTSW 7 66110076 nonsense probably null
R0669:Chsy1 UTSW 7 66171687 missense probably damaging 1.00
R1336:Chsy1 UTSW 7 66125239 splice site probably null
R1499:Chsy1 UTSW 7 66172002 missense probably damaging 1.00
R1640:Chsy1 UTSW 7 66171514 missense probably benign 0.34
R1674:Chsy1 UTSW 7 66171663 missense probably damaging 1.00
R1812:Chsy1 UTSW 7 66171817 missense probably benign 0.12
R1934:Chsy1 UTSW 7 66172243 missense probably damaging 1.00
R2964:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R2965:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R2966:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R3692:Chsy1 UTSW 7 66171253 missense probably damaging 1.00
R4890:Chsy1 UTSW 7 66110226 missense probably benign 0.00
R5373:Chsy1 UTSW 7 66110076 nonsense probably null
R5936:Chsy1 UTSW 7 66172277 missense possibly damaging 0.89
R6149:Chsy1 UTSW 7 66125385 missense probably damaging 1.00
R6192:Chsy1 UTSW 7 66170877 missense probably benign 0.29
R6653:Chsy1 UTSW 7 66110193 missense probably benign 0.10
R6848:Chsy1 UTSW 7 66171037 missense probably damaging 1.00
R7318:Chsy1 UTSW 7 66110229 critical splice donor site probably null
R7514:Chsy1 UTSW 7 66172120 missense probably damaging 1.00
R7560:Chsy1 UTSW 7 66171244 missense possibly damaging 0.85
R7560:Chsy1 UTSW 7 66171571 missense probably damaging 1.00
R7655:Chsy1 UTSW 7 66171030 missense probably damaging 0.98
R7656:Chsy1 UTSW 7 66171030 missense probably damaging 0.98
R8410:Chsy1 UTSW 7 66125463 missense probably damaging 1.00
X0012:Chsy1 UTSW 7 66172168 missense probably damaging 1.00
X0063:Chsy1 UTSW 7 66171924 missense probably benign 0.05
Z1176:Chsy1 UTSW 7 66172226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAGTGACACTTACTTACGC -3'
(R):5'- GTGGCTGAGTATAAGTATTTCCCAG -3'

Sequencing Primer
(F):5'- GGAGTGACACTTACTTACGCAGTTC -3'
(R):5'- GTATTTCCCAGTAAGGAACTCCC -3'
Posted On2021-01-18