Incidental Mutation 'R8478:Gria4'
ID 657384
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Name glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms Gluralpha4, spkw1, Glur4, Glur-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.805) question?
Stock # R8478 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 4417896-4796234 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 4793882 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 59 (E59K)
Ref Sequence ENSEMBL: ENSMUSP00000129316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]
AlphaFold Q9Z2W8
Predicted Effect probably damaging
Transcript: ENSMUST00000027020
AA Change: E59K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: E59K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000063508
AA Change: E59K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: E59K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163309
AA Change: E59K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892
AA Change: E59K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3.2e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212533
AA Change: E59K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.1030 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,033,277 D511V possibly damaging Het
Actl11 A T 9: 107,928,645 I56F possibly damaging Het
Adgrl3 G T 5: 81,794,501 R1357L possibly damaging Het
Alpk1 T A 3: 127,729,312 D27V probably damaging Het
Als2 T C 1: 59,186,016 E986G probably damaging Het
Ankle2 T A 5: 110,252,952 L717Q possibly damaging Het
Arl8b A G 6: 108,783,324 T24A possibly damaging Het
Atp2a1 A G 7: 126,448,330 I718T probably damaging Het
Atp6v0e2 T A 6: 48,540,097 N70K probably benign Het
Bcl11a A G 11: 24,165,086 S810G probably damaging Het
Bcl2a1d T G 9: 88,723,435 *173S probably null Het
Cacna1g A G 11: 94,426,452 Y1494H probably damaging Het
Ccdc7a T C 8: 128,761,369 K186E possibly damaging Het
Cfap43 T C 19: 47,776,076 I817V probably benign Het
Chd5 C T 4: 152,356,690 R196* probably null Het
Chsy1 C T 7: 66,171,000 H328Y probably benign Het
Clcn3 A T 8: 60,919,488 S713T probably benign Het
Csrnp3 A T 2: 65,878,056 probably null Het
Dnhd1 A G 7: 105,682,794 N86S probably benign Het
Epha3 T C 16: 63,773,081 T215A probably damaging Het
Fam129a C A 1: 151,636,512 T55K possibly damaging Het
Fgf1 T C 18: 38,854,891 probably null Het
Fosl1 T C 19: 5,454,919 S145P probably damaging Het
Frem3 T A 8: 80,611,558 V160E probably damaging Het
Galk2 A T 2: 125,929,585 K177* probably null Het
Gm35339 T C 15: 76,363,429 probably null Het
Gria1 T C 11: 57,309,842 Y782H probably damaging Het
Ighv1-11 A G 12: 114,612,299 Y99H possibly damaging Het
Insm2 A T 12: 55,600,545 Y358F probably damaging Het
Marveld3 C T 8: 109,961,968 G47D probably damaging Het
Mthfd1l A G 10: 4,148,064 D967G probably damaging Het
Nav2 G T 7: 49,461,985 M746I probably damaging Het
Nmnat1 A G 4: 149,473,384 I67T possibly damaging Het
Nub1 G T 5: 24,701,424 R316L probably benign Het
Nxn A G 11: 76,274,043 V214A probably damaging Het
Olfr669 C A 7: 104,939,270 S248Y probably benign Het
Pelp1 A T 11: 70,394,320 D907E unknown Het
Pik3c2a A T 7: 116,418,349 S58T probably damaging Het
Pik3ca A G 3: 32,451,848 N703S probably benign Het
Polr3c G A 3: 96,716,750 probably benign Het
Pon1 C T 6: 5,185,318 G61R probably damaging Het
Pou2f1 A T 1: 165,931,718 M1K probably null Het
Prkdc T A 16: 15,648,924 C90S probably benign Het
Prokr1 A G 6: 87,581,348 Y352H probably benign Het
Rhod C T 19: 4,426,691 R134H probably damaging Het
Rufy3 C T 5: 88,615,036 R110W probably damaging Het
Sema4c A T 1: 36,551,790 M460K probably benign Het
Slc46a3 T C 5: 147,879,153 S455G probably benign Het
Smyd1 A T 6: 71,216,827 H371Q probably damaging Het
Steap1 A G 5: 5,736,432 M335T probably benign Het
Suox A G 10: 128,671,052 V369A probably damaging Het
Thbs2 T C 17: 14,680,404 I514V probably benign Het
Tie1 A T 4: 118,484,782 probably null Het
Tmem131l T C 3: 83,898,462 E1558G probably damaging Het
Tpcn1 G T 5: 120,560,321 H45Q probably benign Het
Ush1c A G 7: 46,221,433 S327P probably damaging Het
Ush2a G A 1: 188,443,232 V1176M possibly damaging Het
Utrn A G 10: 12,649,148 M2197T probably benign Het
Vmn1r50 G T 6: 90,108,089 C272F probably benign Het
Vmn2r10 A T 5: 108,995,770 N771K probably damaging Het
Vmn2r2 A T 3: 64,116,836 F691I possibly damaging Het
Vmn2r53 T C 7: 12,606,354 Q64R probably benign Het
Vmn2r95 G T 17: 18,452,282 L760F probably damaging Het
Xdh C A 17: 73,906,058 E863D probably benign Het
Ykt6 A G 11: 5,962,407 Y120C possibly damaging Het
Zranb2 A G 3: 157,546,108 *321W probably null Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4472202 missense probably damaging 0.98
IGL01451:Gria4 APN 9 4503652 missense probably benign 0.04
IGL01533:Gria4 APN 9 4502395 missense probably damaging 1.00
IGL01994:Gria4 APN 9 4537726 missense probably damaging 1.00
IGL02078:Gria4 APN 9 4793878 missense probably damaging 0.98
IGL02183:Gria4 APN 9 4502460 missense probably damaging 1.00
IGL02351:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4793804 splice site probably benign
IGL03131:Gria4 APN 9 4432876 missense probably damaging 0.96
IGL03148:Gria4 APN 9 4464295 missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4513288 missense probably benign
PIT4812001:Gria4 UTSW 9 4427128 missense probably damaging 1.00
R0018:Gria4 UTSW 9 4432843 missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4793840 missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4464372 missense probably benign 0.32
R0690:Gria4 UTSW 9 4427071 missense probably damaging 1.00
R0992:Gria4 UTSW 9 4795238 missense probably benign
R1517:Gria4 UTSW 9 4793865 missense probably damaging 1.00
R1673:Gria4 UTSW 9 4537637 nonsense probably null
R1713:Gria4 UTSW 9 4424448 missense probably benign 0.20
R1961:Gria4 UTSW 9 4519546 splice site probably benign
R2137:Gria4 UTSW 9 4427026 intron probably benign
R2397:Gria4 UTSW 9 4537717 missense probably damaging 1.00
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R3014:Gria4 UTSW 9 4464294 missense probably damaging 0.97
R3412:Gria4 UTSW 9 4513278 missense probably benign 0.00
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3733:Gria4 UTSW 9 4513295 missense probably benign
R3897:Gria4 UTSW 9 4513260 missense probably damaging 1.00
R4404:Gria4 UTSW 9 4464489 splice site probably null
R4457:Gria4 UTSW 9 4427074 missense probably damaging 1.00
R4672:Gria4 UTSW 9 4664981 missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4464295 missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4472176 missense probably benign 0.01
R5109:Gria4 UTSW 9 4472168 missense probably damaging 1.00
R5202:Gria4 UTSW 9 4424330 missense probably benign 0.10
R5828:Gria4 UTSW 9 4432832 missense probably damaging 1.00
R5945:Gria4 UTSW 9 4456122 missense probably damaging 1.00
R5985:Gria4 UTSW 9 4503593 missense probably damaging 0.99
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6111:Gria4 UTSW 9 4502430 missense probably damaging 1.00
R6190:Gria4 UTSW 9 4420199 missense probably benign
R6280:Gria4 UTSW 9 4456072 missense probably damaging 1.00
R6406:Gria4 UTSW 9 4427077 missense probably damaging 1.00
R6470:Gria4 UTSW 9 4503680 missense probably damaging 1.00
R6485:Gria4 UTSW 9 4464249 missense probably damaging 1.00
R6612:Gria4 UTSW 9 4472206 missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4793822 missense probably damaging 1.00
R7046:Gria4 UTSW 9 4420278 missense probably damaging 0.97
R7210:Gria4 UTSW 9 4464135 missense probably damaging 1.00
R7284:Gria4 UTSW 9 4472017 missense probably damaging 1.00
R7475:Gria4 UTSW 9 4513330 missense probably damaging 1.00
R7501:Gria4 UTSW 9 4502436 missense probably benign 0.01
R7536:Gria4 UTSW 9 4464298 missense probably damaging 1.00
R7604:Gria4 UTSW 9 4464315 missense probably damaging 1.00
R7643:Gria4 UTSW 9 4793950 missense probably benign 0.00
R7669:Gria4 UTSW 9 4462029 missense probably damaging 1.00
R7703:Gria4 UTSW 9 4503588 missense probably benign
R7720:Gria4 UTSW 9 4464288 missense probably damaging 1.00
R7724:Gria4 UTSW 9 4472074 missense probably damaging 1.00
R7909:Gria4 UTSW 9 4464450 missense probably damaging 1.00
R8007:Gria4 UTSW 9 4503740 splice site probably benign
R8044:Gria4 UTSW 9 4456216 missense probably damaging 1.00
R8062:Gria4 UTSW 9 4480273 missense possibly damaging 0.54
R8131:Gria4 UTSW 9 4502429 missense probably benign 0.16
R8212:Gria4 UTSW 9 4480242 missense probably benign
R8699:Gria4 UTSW 9 4424347 missense probably damaging 1.00
R8699:Gria4 UTSW 9 4424351 missense probably damaging 1.00
R8785:Gria4 UTSW 9 4456106 missense probably damaging 1.00
R8785:Gria4 UTSW 9 4795189 missense possibly damaging 0.92
R8888:Gria4 UTSW 9 4664951 missense probably damaging 1.00
R8895:Gria4 UTSW 9 4664951 missense probably damaging 1.00
R9160:Gria4 UTSW 9 4424412 missense probably damaging 1.00
X0023:Gria4 UTSW 9 4427067 missense probably damaging 1.00
X0065:Gria4 UTSW 9 4464340 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CAGTTTATGTGATCCATGCAGG -3'
(R):5'- GGCAAAGAGCTCCTTAATTGTGTG -3'

Sequencing Primer
(F):5'- TCCATGCAGGAAAATTAAAAGGC -3'
(R):5'- AAGAGCTCCTTAATTGTGTGTGCTTG -3'
Posted On 2021-01-18