Incidental Mutation 'R8478:Xdh'
ID657402
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Namexanthine dehydrogenase
Synonymsxanthine oxidase, XO, Xor, Xox1, Xox-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R8478 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location73883908-73950182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73906058 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 863 (E863D)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably benign
Transcript: ENSMUST00000024866
AA Change: E863D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: E863D

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,033,277 D511V possibly damaging Het
Actl11 A T 9: 107,928,645 I56F possibly damaging Het
Adgrl3 G T 5: 81,794,501 R1357L possibly damaging Het
Alpk1 T A 3: 127,729,312 D27V probably damaging Het
Als2 T C 1: 59,186,016 E986G probably damaging Het
Ankle2 T A 5: 110,252,952 L717Q possibly damaging Het
Arl8b A G 6: 108,783,324 T24A possibly damaging Het
Atp2a1 A G 7: 126,448,330 I718T probably damaging Het
Atp6v0e2 T A 6: 48,540,097 N70K probably benign Het
Bcl11a A G 11: 24,165,086 S810G probably damaging Het
Bcl2a1d T G 9: 88,723,435 *173S probably null Het
Cacna1g A G 11: 94,426,452 Y1494H probably damaging Het
Ccdc7a T C 8: 128,761,369 K186E possibly damaging Het
Cfap43 T C 19: 47,776,076 I817V probably benign Het
Chd5 C T 4: 152,356,690 R196* probably null Het
Chsy1 C T 7: 66,171,000 H328Y probably benign Het
Clcn3 A T 8: 60,919,488 S713T probably benign Het
Csrnp3 A T 2: 65,878,056 probably null Het
Dnhd1 A G 7: 105,682,794 N86S probably benign Het
Epha3 T C 16: 63,773,081 T215A probably damaging Het
Fam129a C A 1: 151,636,512 T55K possibly damaging Het
Fgf1 T C 18: 38,854,891 probably null Het
Fosl1 T C 19: 5,454,919 S145P probably damaging Het
Frem3 T A 8: 80,611,558 V160E probably damaging Het
Galk2 A T 2: 125,929,585 K177* probably null Het
Gm35339 T C 15: 76,363,429 probably null Het
Gria1 T C 11: 57,309,842 Y782H probably damaging Het
Gria4 C T 9: 4,793,882 E59K probably damaging Het
Ighv1-11 A G 12: 114,612,299 Y99H possibly damaging Het
Insm2 A T 12: 55,600,545 Y358F probably damaging Het
Marveld3 C T 8: 109,961,968 G47D probably damaging Het
Mthfd1l A G 10: 4,148,064 D967G probably damaging Het
Nav2 G T 7: 49,461,985 M746I probably damaging Het
Nmnat1 A G 4: 149,473,384 I67T possibly damaging Het
Nub1 G T 5: 24,701,424 R316L probably benign Het
Nxn A G 11: 76,274,043 V214A probably damaging Het
Olfr669 C A 7: 104,939,270 S248Y probably benign Het
Pelp1 A T 11: 70,394,320 D907E unknown Het
Pik3c2a A T 7: 116,418,349 S58T probably damaging Het
Pik3ca A G 3: 32,451,848 N703S probably benign Het
Polr3c G A 3: 96,716,750 probably benign Het
Pon1 C T 6: 5,185,318 G61R probably damaging Het
Pou2f1 A T 1: 165,931,718 M1K probably null Het
Prkdc T A 16: 15,648,924 C90S probably benign Het
Prokr1 A G 6: 87,581,348 Y352H probably benign Het
Rhod C T 19: 4,426,691 R134H probably damaging Het
Rufy3 C T 5: 88,615,036 R110W probably damaging Het
Sema4c A T 1: 36,551,790 M460K probably benign Het
Slc46a3 T C 5: 147,879,153 S455G probably benign Het
Smyd1 A T 6: 71,216,827 H371Q probably damaging Het
Steap1 A G 5: 5,736,432 M335T probably benign Het
Suox A G 10: 128,671,052 V369A probably damaging Het
Thbs2 T C 17: 14,680,404 I514V probably benign Het
Tie1 A T 4: 118,484,782 probably null Het
Tmem131l T C 3: 83,898,462 E1558G probably damaging Het
Tpcn1 G T 5: 120,560,321 H45Q probably benign Het
Ush1c A G 7: 46,221,433 S327P probably damaging Het
Ush2a G A 1: 188,443,232 V1176M possibly damaging Het
Utrn A G 10: 12,649,148 M2197T probably benign Het
Vmn1r50 G T 6: 90,108,089 C272F probably benign Het
Vmn2r10 A T 5: 108,995,770 N771K probably damaging Het
Vmn2r2 A T 3: 64,116,836 F691I possibly damaging Het
Vmn2r53 T C 7: 12,606,354 Q64R probably benign Het
Vmn2r95 G T 17: 18,452,282 L760F probably damaging Het
Ykt6 A G 11: 5,962,407 Y120C possibly damaging Het
Zranb2 A G 3: 157,546,108 *321W probably null Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8350:Xdh UTSW 17 73934842 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
R8465:Xdh UTSW 17 73899012 nonsense probably null
R8680:Xdh UTSW 17 73922505 missense probably benign
R8802:Xdh UTSW 17 73918410 missense probably benign 0.00
R8984:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8985:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8995:Xdh UTSW 17 73898374 missense probably damaging 1.00
R9035:Xdh UTSW 17 73910227 missense probably benign
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCTCTGCTTAGAGATTGTCCAAG -3'
(R):5'- AGGACATGCTCATAACTGGTGG -3'

Sequencing Primer
(F):5'- TCCAAGGACGGGAAGCTG -3'
(R):5'- TGCTCATAACTGGTGGCAGACATC -3'
Posted On2021-01-18