Incidental Mutation 'R8478:Xdh'
ID 657402
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 067922-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R8478 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 74213053 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 863 (E863D)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably benign
Transcript: ENSMUST00000024866
AA Change: E863D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: E863D

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A T 9: 107,805,844 (GRCm39) I56F possibly damaging Het
Adgrl3 G T 5: 81,942,348 (GRCm39) R1357L possibly damaging Het
Alpk1 T A 3: 127,522,961 (GRCm39) D27V probably damaging Het
Als2 T C 1: 59,225,175 (GRCm39) E986G probably damaging Het
Ankle2 T A 5: 110,400,818 (GRCm39) L717Q possibly damaging Het
Arl8b A G 6: 108,760,285 (GRCm39) T24A possibly damaging Het
Atp2a1 A G 7: 126,047,502 (GRCm39) I718T probably damaging Het
Atp6v0e2 T A 6: 48,517,031 (GRCm39) N70K probably benign Het
Bcl11a A G 11: 24,115,086 (GRCm39) S810G probably damaging Het
Bcl2a1d T G 9: 88,605,488 (GRCm39) *173S probably null Het
Bltp1 A T 3: 37,087,426 (GRCm39) D511V possibly damaging Het
Cacna1g A G 11: 94,317,278 (GRCm39) Y1494H probably damaging Het
Ccdc7a T C 8: 129,487,850 (GRCm39) K186E possibly damaging Het
Cfap43 T C 19: 47,764,515 (GRCm39) I817V probably benign Het
Chd5 C T 4: 152,441,147 (GRCm39) R196* probably null Het
Chsy1 C T 7: 65,820,748 (GRCm39) H328Y probably benign Het
Clcn3 A T 8: 61,372,522 (GRCm39) S713T probably benign Het
Csrnp3 A T 2: 65,708,400 (GRCm39) probably null Het
Dnhd1 A G 7: 105,332,001 (GRCm39) N86S probably benign Het
Epha3 T C 16: 63,593,444 (GRCm39) T215A probably damaging Het
Fgf1 T C 18: 38,987,944 (GRCm39) probably null Het
Fosl1 T C 19: 5,504,947 (GRCm39) S145P probably damaging Het
Frem3 T A 8: 81,338,187 (GRCm39) V160E probably damaging Het
Galk2 A T 2: 125,771,505 (GRCm39) K177* probably null Het
Gria1 T C 11: 57,200,668 (GRCm39) Y782H probably damaging Het
Gria4 C T 9: 4,793,882 (GRCm39) E59K probably damaging Het
Ighv1-11 A G 12: 114,575,919 (GRCm39) Y99H possibly damaging Het
Insm2 A T 12: 55,647,330 (GRCm39) Y358F probably damaging Het
Marveld3 C T 8: 110,688,600 (GRCm39) G47D probably damaging Het
Mthfd1l A G 10: 4,098,064 (GRCm39) D967G probably damaging Het
Nav2 G T 7: 49,111,733 (GRCm39) M746I probably damaging Het
Niban1 C A 1: 151,512,263 (GRCm39) T55K possibly damaging Het
Nmnat1 A G 4: 149,557,841 (GRCm39) I67T possibly damaging Het
Nub1 G T 5: 24,906,422 (GRCm39) R316L probably benign Het
Nxn A G 11: 76,164,869 (GRCm39) V214A probably damaging Het
Or52n5 C A 7: 104,588,477 (GRCm39) S248Y probably benign Het
Pelp1 A T 11: 70,285,146 (GRCm39) D907E unknown Het
Pik3c2a A T 7: 116,017,584 (GRCm39) S58T probably damaging Het
Pik3ca A G 3: 32,505,997 (GRCm39) N703S probably benign Het
Polr3c G A 3: 96,624,066 (GRCm39) probably benign Het
Pon1 C T 6: 5,185,318 (GRCm39) G61R probably damaging Het
Pou2f1 A T 1: 165,759,287 (GRCm39) M1K probably null Het
Prkdc T A 16: 15,466,788 (GRCm39) C90S probably benign Het
Prokr1 A G 6: 87,558,330 (GRCm39) Y352H probably benign Het
Rhod C T 19: 4,476,719 (GRCm39) R134H probably damaging Het
Rufy3 C T 5: 88,762,895 (GRCm39) R110W probably damaging Het
Sema4c A T 1: 36,590,871 (GRCm39) M460K probably benign Het
Slc46a3 T C 5: 147,815,963 (GRCm39) S455G probably benign Het
Smyd1 A T 6: 71,193,811 (GRCm39) H371Q probably damaging Het
Steap1 A G 5: 5,786,432 (GRCm39) M335T probably benign Het
Suox A G 10: 128,506,921 (GRCm39) V369A probably damaging Het
Thbs2 T C 17: 14,900,666 (GRCm39) I514V probably benign Het
Tie1 A T 4: 118,341,979 (GRCm39) probably null Het
Tmem131l T C 3: 83,805,769 (GRCm39) E1558G probably damaging Het
Tpcn1 G T 5: 120,698,386 (GRCm39) H45Q probably benign Het
Ush1c A G 7: 45,870,857 (GRCm39) S327P probably damaging Het
Ush2a G A 1: 188,175,429 (GRCm39) V1176M possibly damaging Het
Utrn A G 10: 12,524,892 (GRCm39) M2197T probably benign Het
Vmn1r50 G T 6: 90,085,071 (GRCm39) C272F probably benign Het
Vmn2r10 A T 5: 109,143,636 (GRCm39) N771K probably damaging Het
Vmn2r2 A T 3: 64,024,257 (GRCm39) F691I possibly damaging Het
Vmn2r53 T C 7: 12,340,281 (GRCm39) Q64R probably benign Het
Vmn2r95 G T 17: 18,672,544 (GRCm39) L760F probably damaging Het
Wdr97 T C 15: 76,247,629 (GRCm39) probably null Het
Ykt6 A G 11: 5,912,407 (GRCm39) Y120C possibly damaging Het
Zranb2 A G 3: 157,251,745 (GRCm39) *321W probably null Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCTCTGCTTAGAGATTGTCCAAG -3'
(R):5'- AGGACATGCTCATAACTGGTGG -3'

Sequencing Primer
(F):5'- TCCAAGGACGGGAAGCTG -3'
(R):5'- TGCTCATAACTGGTGGCAGACATC -3'
Posted On 2021-01-18