Mutagenetix > Incidental Mutation

Incidental Mutation 'R8479:Cse1l'

657411

Institutional Source

Beutler Lab

Gene Symbol

Cse1l

Ensembl Gene

ENSMUSG00000002718

Gene Name

chromosome segregation 1-like (S. cerevisiae)

Synonyms

Capts, Xpo2, 2610100P18Rik, Cas

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8479 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

166906040-166946389 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 166921973 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 78 (E78K)

Ref Sequence

ENSEMBL: ENSMUSP00000002790 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000168599] [ENSMUST00000169290]

AlphaFold

Q9ERK4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002790
AA Change: E78K

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: E78K

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	526	9.2e-169	PFAM
Pfam:CAS_CSE1	527	962	1.1e-181	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168599
AA Change: E78K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: E78K

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	256	8.6e-40	PFAM
Pfam:Cse1	255	470	7.3e-99	PFAM
Pfam:CAS_CSE1	471	906	1.3e-201	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169290
AA Change: E78K

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718
AA Change: E78K

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	389	5.2e-102	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4galt	G	A	15: 83,227,860	H241Y	probably benign	Het
Afg3l2	C	T	18: 67,448,916	G29D	probably benign	Het
Ano2	T	C	6: 125,712,160	S52P	possibly damaging	Het
Atp11a	A	T	8: 12,842,932	E641V	possibly damaging	Het
Atp6v1d	T	C	12: 78,849,746	T116A	probably benign	Het
BC025446	A	G	15: 75,217,777	T45A	probably damaging	Het
Cacna2d2	T	C	9: 107,526,397		probably null	Het
Cd109	T	A	9: 78,667,346	Y537*	probably null	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Celsr2	T	A	3: 108,398,902	T2029S	probably benign	Het
Cntnap2	C	T	6: 46,759,773	A711V	probably benign	Het
Col18a1	T	C	10: 77,081,154	I114V	unknown	Het
Crhbp	A	G	13: 95,442,124	V163A	possibly damaging	Het
Crmp1	C	A	5: 37,284,158	P414Q	possibly damaging	Het
Ctnna2	A	G	6: 77,758,590	V35A	probably damaging	Het
Ddx1	T	A	12: 13,220,748	N654I	probably damaging	Het
Dgcr14	T	C	16: 17,910,941		probably null	Het
Dido1	A	T	2: 180,673,229		probably null	Het
Dmtf1	C	T	5: 9,120,428	V630I	probably damaging	Het
Ercc6	T	C	14: 32,526,406	S305P	probably benign	Het
Ercc6l2	T	A	13: 63,824,815	S37T	possibly damaging	Het
Fnip2	A	G	3: 79,512,555	M138T	probably damaging	Het
Galnt9	T	C	5: 110,544,751	V17A	probably benign	Het
Gm7324	T	C	14: 43,714,763	S288P	probably benign	Het
Gucy2e	G	A	11: 69,232,963	A370V	probably benign	Het
H2-Bl	G	A	17: 36,084,219	A2V	probably damaging	Het
Ift57	T	C	16: 49,701,900	F2L	probably damaging	Het
Ipo7	G	A	7: 110,039,245	V240I	probably benign	Het
Lrrc4c	A	G	2: 97,629,632	Y201C	probably damaging	Het
Mapkap1	A	T	2: 34,581,290	S389C	probably damaging	Het
Met	G	T	6: 17,491,747		probably null	Het
Misp	T	C	10: 79,827,916	F575L	possibly damaging	Het
Mtmr11	T	C	3: 96,163,734	L136P	probably damaging	Het
Muc4	C	T	16: 32,753,508	T1128M	possibly damaging	Het
Nfyc	A	T	4: 120,768,892	V70E	probably damaging	Het
Nphp4	T	C	4: 152,524,290	S452P	probably benign	Het
Oasl2	T	A	5: 114,897,791	F43I	probably damaging	Het
Olfr1002	A	G	2: 85,648,103	S73P	probably damaging	Het
Olfr1333	A	G	4: 118,830,015	C141R	probably damaging	Het
Pros1	G	T	16: 62,907,739	G269W	probably damaging	Het
Rif1	A	C	2: 52,112,551	S2006R	possibly damaging	Het
Ror2	G	T	13: 53,117,364	N306K	probably damaging	Het
Rragd	C	T	4: 33,018,734	A379V	probably benign	Het
Slc10a2	C	T	8: 5,098,443		probably null	Het
Susd3	C	T	13: 49,237,476	G113S	probably benign	Het
Tbc1d19	T	A	5: 53,883,689	M371K	possibly damaging	Het
Tnn	C	A	1: 160,122,827	R736S	probably benign	Het
Trio	T	C	15: 27,901,200	T323A	probably benign	Het
Ubqln1	G	A	13: 58,191,839	P324S	probably benign	Het
Uspl1	T	C	5: 149,215,194	L1068P	probably damaging	Het
Vmn2r86	A	T	10: 130,446,866	I627N	probably damaging	Het
Wdr35	C	A	12: 8,985,985	T252K	probably benign	Het
Zfp62	T	C	11: 49,216,492	I470T	probably damaging	Het

Other mutations in Cse1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Cse1l	APN	2	166927804	missense	probably damaging	1.00
IGL01306:Cse1l	APN	2	166927508	nonsense	probably null
IGL01672:Cse1l	APN	2	166929967	missense	probably damaging	1.00
IGL02060:Cse1l	APN	2	166930653	missense	probably damaging	1.00
IGL02897:Cse1l	APN	2	166919708	missense	possibly damaging	0.47
IGL03375:Cse1l	APN	2	166943057	splice site	probably benign
ANU23:Cse1l	UTSW	2	166927508	nonsense	probably null
PIT4585001:Cse1l	UTSW	2	166941474	missense	probably damaging	1.00
R0195:Cse1l	UTSW	2	166940088	missense	probably benign
R1114:Cse1l	UTSW	2	166941203	splice site	probably benign
R1539:Cse1l	UTSW	2	166926372	missense	probably benign	0.00
R1721:Cse1l	UTSW	2	166926411	missense	probably damaging	1.00
R1779:Cse1l	UTSW	2	166940124	splice site	probably null
R1913:Cse1l	UTSW	2	166922191	missense	probably damaging	1.00
R2069:Cse1l	UTSW	2	166941492	missense	probably benign	0.01
R2398:Cse1l	UTSW	2	166928997	missense	probably damaging	1.00
R4110:Cse1l	UTSW	2	166942050	missense	probably benign	0.00
R4195:Cse1l	UTSW	2	166929979	missense	probably damaging	1.00
R4603:Cse1l	UTSW	2	166944532	missense	probably benign	0.09
R4686:Cse1l	UTSW	2	166932160	missense	probably damaging	1.00
R4867:Cse1l	UTSW	2	166926403	missense	possibly damaging	0.76
R4942:Cse1l	UTSW	2	166929794	missense	probably damaging	1.00
R5164:Cse1l	UTSW	2	166944428	missense	probably benign	0.02
R5475:Cse1l	UTSW	2	166941254	missense	probably damaging	1.00
R5493:Cse1l	UTSW	2	166941190	intron	probably benign
R5782:Cse1l	UTSW	2	166929001	missense	probably damaging	1.00
R5862:Cse1l	UTSW	2	166915207	missense	probably benign	0.00
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6913:Cse1l	UTSW	2	166929877	missense	possibly damaging	0.65
R7683:Cse1l	UTSW	2	166922788	missense	probably benign
R7871:Cse1l	UTSW	2	166935671	splice site	probably null
R8001:Cse1l	UTSW	2	166939913	missense	probably damaging	1.00
R8057:Cse1l	UTSW	2	166939925	missense	probably damaging	1.00
R8175:Cse1l	UTSW	2	166943208	critical splice donor site	probably null
R8347:Cse1l	UTSW	2	166927585	missense	possibly damaging	0.95
R8386:Cse1l	UTSW	2	166919684	missense	probably benign	0.00
R8973:Cse1l	UTSW	2	166943080	missense	probably damaging	1.00
R9206:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9208:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9522:Cse1l	UTSW	2	166934753	missense	probably benign
R9599:Cse1l	UTSW	2	166941466	missense	probably benign
R9600:Cse1l	UTSW	2	166915199	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTATGGACTAGGCGGTAGGC -3'
(R):5'- CATCACTCAGCTAGGGAAGG -3'

Sequencing Primer
(F):5'- CATGCTCTACAGAGGGAGCTAC -3'
(R):5'- CATCACTCAGCTAGGGAAGGAATGG -3'

Posted On

2021-01-18