Incidental Mutation 'R8479:Olfr1333'
ID 657417
Institutional Source Beutler Lab
Gene Symbol Olfr1333
Ensembl Gene ENSMUSG00000110947
Gene Name olfactory receptor 1333
Synonyms MOR259-11, GA_x6K02T2QD9B-18703033-18703986, MOR259-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R8479 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 118827659-118836279 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118830015 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 141 (C141R)
Ref Sequence ENSEMBL: ENSMUSP00000154759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076019] [ENSMUST00000214477]
AlphaFold Q7TQV7
Predicted Effect probably damaging
Transcript: ENSMUST00000076019
AA Change: C142R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075398
Gene: ENSMUSG00000110947
AA Change: C142R

DomainStartEndE-ValueType
Pfam:7tm_1 42 291 4.1e-31 PFAM
Pfam:7tm_4 140 284 2.9e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214477
AA Change: C141R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214477
AA Change: C141R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4316 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,227,860 H241Y probably benign Het
Afg3l2 C T 18: 67,448,916 G29D probably benign Het
Ano2 T C 6: 125,712,160 S52P possibly damaging Het
Atp11a A T 8: 12,842,932 E641V possibly damaging Het
Atp6v1d T C 12: 78,849,746 T116A probably benign Het
BC025446 A G 15: 75,217,777 T45A probably damaging Het
Cacna2d2 T C 9: 107,526,397 probably null Het
Cd109 T A 9: 78,667,346 Y537* probably null Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Cntnap2 C T 6: 46,759,773 A711V probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Crhbp A G 13: 95,442,124 V163A possibly damaging Het
Crmp1 C A 5: 37,284,158 P414Q possibly damaging Het
Cse1l G A 2: 166,921,973 E78K possibly damaging Het
Ctnna2 A G 6: 77,758,590 V35A probably damaging Het
Ddx1 T A 12: 13,220,748 N654I probably damaging Het
Dgcr14 T C 16: 17,910,941 probably null Het
Dido1 A T 2: 180,673,229 probably null Het
Dmtf1 C T 5: 9,120,428 V630I probably damaging Het
Ercc6 T C 14: 32,526,406 S305P probably benign Het
Ercc6l2 T A 13: 63,824,815 S37T possibly damaging Het
Fnip2 A G 3: 79,512,555 M138T probably damaging Het
Galnt9 T C 5: 110,544,751 V17A probably benign Het
Gm7324 T C 14: 43,714,763 S288P probably benign Het
Gucy2e G A 11: 69,232,963 A370V probably benign Het
H2-Bl G A 17: 36,084,219 A2V probably damaging Het
Ift57 T C 16: 49,701,900 F2L probably damaging Het
Ipo7 G A 7: 110,039,245 V240I probably benign Het
Lrrc4c A G 2: 97,629,632 Y201C probably damaging Het
Mapkap1 A T 2: 34,581,290 S389C probably damaging Het
Met G T 6: 17,491,747 probably null Het
Misp T C 10: 79,827,916 F575L possibly damaging Het
Mtmr11 T C 3: 96,163,734 L136P probably damaging Het
Muc4 C T 16: 32,753,508 T1128M possibly damaging Het
Nfyc A T 4: 120,768,892 V70E probably damaging Het
Nphp4 T C 4: 152,524,290 S452P probably benign Het
Oasl2 T A 5: 114,897,791 F43I probably damaging Het
Olfr1002 A G 2: 85,648,103 S73P probably damaging Het
Pros1 G T 16: 62,907,739 G269W probably damaging Het
Rif1 A C 2: 52,112,551 S2006R possibly damaging Het
Ror2 G T 13: 53,117,364 N306K probably damaging Het
Rragd C T 4: 33,018,734 A379V probably benign Het
Slc10a2 C T 8: 5,098,443 probably null Het
Susd3 C T 13: 49,237,476 G113S probably benign Het
Tbc1d19 T A 5: 53,883,689 M371K possibly damaging Het
Tnn C A 1: 160,122,827 R736S probably benign Het
Trio T C 15: 27,901,200 T323A probably benign Het
Ubqln1 G A 13: 58,191,839 P324S probably benign Het
Uspl1 T C 5: 149,215,194 L1068P probably damaging Het
Vmn2r86 A T 10: 130,446,866 I627N probably damaging Het
Wdr35 C A 12: 8,985,985 T252K probably benign Het
Zfp62 T C 11: 49,216,492 I470T probably damaging Het
Other mutations in Olfr1333
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Olfr1333 APN 4 118829792 missense probably benign 0.30
IGL03023:Olfr1333 APN 4 118830252 missense probably damaging 0.99
IGL03387:Olfr1333 APN 4 118830041 missense probably damaging 1.00
R0326:Olfr1333 UTSW 4 118829825 missense possibly damaging 0.90
R0532:Olfr1333 UTSW 4 118829700 missense probably damaging 1.00
R1775:Olfr1333 UTSW 4 118829868 missense probably benign 0.00
R1906:Olfr1333 UTSW 4 118830270 missense probably damaging 1.00
R1946:Olfr1333 UTSW 4 118830026 missense probably benign 0.00
R2260:Olfr1333 UTSW 4 118830162 missense probably damaging 1.00
R5084:Olfr1333 UTSW 4 118829570 missense probably damaging 1.00
R5337:Olfr1333 UTSW 4 118829666 missense probably benign 0.44
R5444:Olfr1333 UTSW 4 118830111 missense probably benign
R5817:Olfr1333 UTSW 4 118830099 missense probably damaging 0.96
R5973:Olfr1333 UTSW 4 118830216 missense probably benign 0.22
R5987:Olfr1333 UTSW 4 118830281 missense probably damaging 0.96
R6031:Olfr1333 UTSW 4 118830391 splice site probably null
R6031:Olfr1333 UTSW 4 118830391 splice site probably null
R7255:Olfr1333 UTSW 4 118829952 missense probably benign 0.17
R7483:Olfr1333 UTSW 4 118830320 missense probably damaging 0.98
R8214:Olfr1333 UTSW 4 118830091 missense probably benign
R8847:Olfr1333 UTSW 4 118829624 missense probably damaging 0.97
Z1176:Olfr1333 UTSW 4 118830050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATACGAATGTAGGAGGCCAC -3'
(R):5'- ACTACCATGCCCCAGATGTTG -3'

Sequencing Primer
(F):5'- AGACCAAGTCCACCATCTCAATGATG -3'
(R):5'- CCCCAGATGTTGGTGCATC -3'
Posted On 2021-01-18