Incidental Mutation 'R8479:Cntnap2'
ID 657426
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms Caspr2, 5430425M22Rik
MMRRC Submission 067923-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8479 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 45036995-47278330 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 46736707 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 711 (A711V)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000114641
AA Change: A711V

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: A711V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,112,061 (GRCm39) H241Y probably benign Het
Afg3l2 C T 18: 67,581,986 (GRCm39) G29D probably benign Het
Ano2 T C 6: 125,689,123 (GRCm39) S52P possibly damaging Het
Atp11a A T 8: 12,892,932 (GRCm39) E641V possibly damaging Het
Atp6v1d T C 12: 78,896,520 (GRCm39) T116A probably benign Het
Cacna2d2 T C 9: 107,403,596 (GRCm39) probably null Het
Cd109 T A 9: 78,574,628 (GRCm39) Y537* probably null Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col18a1 T C 10: 76,916,988 (GRCm39) I114V unknown Het
Crhbp A G 13: 95,578,632 (GRCm39) V163A possibly damaging Het
Crmp1 C A 5: 37,441,502 (GRCm39) P414Q possibly damaging Het
Cse1l G A 2: 166,763,893 (GRCm39) E78K possibly damaging Het
Ctnna2 A G 6: 77,735,573 (GRCm39) V35A probably damaging Het
Ddx1 T A 12: 13,270,749 (GRCm39) N654I probably damaging Het
Dido1 A T 2: 180,315,022 (GRCm39) probably null Het
Dmtf1 C T 5: 9,170,428 (GRCm39) V630I probably damaging Het
Ercc6 T C 14: 32,248,363 (GRCm39) S305P probably benign Het
Ercc6l2 T A 13: 63,972,629 (GRCm39) S37T possibly damaging Het
Ess2 T C 16: 17,728,805 (GRCm39) probably null Het
Fnip2 A G 3: 79,419,862 (GRCm39) M138T probably damaging Het
Galnt9 T C 5: 110,692,617 (GRCm39) V17A probably benign Het
Gm7324 T C 14: 43,952,220 (GRCm39) S288P probably benign Het
Gucy2e G A 11: 69,123,789 (GRCm39) A370V probably benign Het
H2-T13 G A 17: 36,395,111 (GRCm39) A2V probably damaging Het
Ift57 T C 16: 49,522,263 (GRCm39) F2L probably damaging Het
Ipo7 G A 7: 109,638,452 (GRCm39) V240I probably benign Het
Lrrc4c A G 2: 97,459,977 (GRCm39) Y201C probably damaging Het
Ly6g2 A G 15: 75,089,626 (GRCm39) T45A probably damaging Het
Mapkap1 A T 2: 34,471,302 (GRCm39) S389C probably damaging Het
Met G T 6: 17,491,746 (GRCm39) probably null Het
Misp T C 10: 79,663,750 (GRCm39) F575L possibly damaging Het
Mtmr11 T C 3: 96,071,051 (GRCm39) L136P probably damaging Het
Muc4 C T 16: 32,574,799 (GRCm39) T1128M possibly damaging Het
Nfyc A T 4: 120,626,089 (GRCm39) V70E probably damaging Het
Nphp4 T C 4: 152,608,747 (GRCm39) S452P probably benign Het
Oasl2 T A 5: 115,035,852 (GRCm39) F43I probably damaging Het
Or10ak11 A G 4: 118,687,212 (GRCm39) C141R probably damaging Het
Or5g25 A G 2: 85,478,447 (GRCm39) S73P probably damaging Het
Pros1 G T 16: 62,728,102 (GRCm39) G269W probably damaging Het
Rif1 A C 2: 52,002,563 (GRCm39) S2006R possibly damaging Het
Ror2 G T 13: 53,271,400 (GRCm39) N306K probably damaging Het
Rragd C T 4: 33,018,734 (GRCm39) A379V probably benign Het
Slc10a2 C T 8: 5,148,443 (GRCm39) probably null Het
Susd3 C T 13: 49,390,952 (GRCm39) G113S probably benign Het
Tbc1d19 T A 5: 54,041,031 (GRCm39) M371K possibly damaging Het
Tnn C A 1: 159,950,397 (GRCm39) R736S probably benign Het
Trio T C 15: 27,901,286 (GRCm39) T323A probably benign Het
Ubqln1 G A 13: 58,339,653 (GRCm39) P324S probably benign Het
Uspl1 T C 5: 149,152,004 (GRCm39) L1068P probably damaging Het
Vmn2r86 A T 10: 130,282,735 (GRCm39) I627N probably damaging Het
Wdr35 C A 12: 9,035,985 (GRCm39) T252K probably benign Het
Zfp62 T C 11: 49,107,319 (GRCm39) I470T probably damaging Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 45,992,197 (GRCm39) missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46,965,721 (GRCm39) missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47,169,972 (GRCm39) missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46,461,006 (GRCm39) missense probably benign
IGL00857:Cntnap2 APN 6 47,026,358 (GRCm39) missense probably benign 0.00
IGL01290:Cntnap2 APN 6 45,992,399 (GRCm39) missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47,169,947 (GRCm39) missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47,248,305 (GRCm39) nonsense probably null
IGL01859:Cntnap2 APN 6 46,965,655 (GRCm39) missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46,211,137 (GRCm39) missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 46,998,588 (GRCm39) missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46,211,254 (GRCm39) missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 46,998,670 (GRCm39) missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47,072,483 (GRCm39) missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46,147,179 (GRCm39) missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46,507,105 (GRCm39) missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46,460,917 (GRCm39) missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45,037,326 (GRCm39) splice site probably null
R0352:Cntnap2 UTSW 6 45,969,018 (GRCm39) splice site probably null
R0389:Cntnap2 UTSW 6 45,986,571 (GRCm39) missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45,692,750 (GRCm39) missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46,506,839 (GRCm39) nonsense probably null
R0611:Cntnap2 UTSW 6 47,072,483 (GRCm39) missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46,965,694 (GRCm39) missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47,273,642 (GRCm39) splice site probably benign
R0976:Cntnap2 UTSW 6 47,248,164 (GRCm39) missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1387:Cntnap2 UTSW 6 47,084,848 (GRCm39) missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46,507,613 (GRCm39) missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 45,992,264 (GRCm39) missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47,084,826 (GRCm39) nonsense probably null
R1757:Cntnap2 UTSW 6 46,736,763 (GRCm39) missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46,965,609 (GRCm39) missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46,507,567 (GRCm39) missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47,275,522 (GRCm39) missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47,275,379 (GRCm39) missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 45,992,200 (GRCm39) missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45,968,837 (GRCm39) missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4030:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4237:Cntnap2 UTSW 6 46,507,324 (GRCm39) intron probably benign
R4445:Cntnap2 UTSW 6 46,736,785 (GRCm39) missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4918:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4999:Cntnap2 UTSW 6 45,897,768 (GRCm39) missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45,897,860 (GRCm39) nonsense probably null
R5748:Cntnap2 UTSW 6 45,692,818 (GRCm39) missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46,506,749 (GRCm39) intron probably benign
R6118:Cntnap2 UTSW 6 47,170,011 (GRCm39) missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46,736,742 (GRCm39) missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47,248,232 (GRCm39) missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45,037,046 (GRCm39) splice site probably null
R6385:Cntnap2 UTSW 6 46,833,114 (GRCm39) missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46,736,694 (GRCm39) missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46,147,206 (GRCm39) missense probably benign 0.25
R6610:Cntnap2 UTSW 6 45,992,191 (GRCm39) missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46,965,580 (GRCm39) missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47,248,205 (GRCm39) missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46,460,963 (GRCm39) missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46,324,079 (GRCm39) missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47,072,627 (GRCm39) missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R8503:Cntnap2 UTSW 6 45,968,975 (GRCm39) missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47,026,156 (GRCm39) missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 45,978,161 (GRCm39) missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46,833,076 (GRCm39) missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46,460,983 (GRCm39) missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46,461,139 (GRCm39) intron probably benign
R9209:Cntnap2 UTSW 6 47,026,183 (GRCm39) missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 45,978,112 (GRCm39) missense probably benign 0.00
R9310:Cntnap2 UTSW 6 45,978,281 (GRCm39) missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 45,978,244 (GRCm39) missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46,211,217 (GRCm39) missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 45,992,165 (GRCm39) missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45,969,009 (GRCm39) missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46,965,726 (GRCm39) missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 45,992,373 (GRCm39) frame shift probably null
R9745:Cntnap2 UTSW 6 46,211,100 (GRCm39) missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47,026,261 (GRCm39) missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 46,998,599 (GRCm39) missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 45,986,452 (GRCm39) missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 46,998,688 (GRCm39) missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46,211,179 (GRCm39) missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47,248,082 (GRCm39) missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 45,992,233 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCATTTAGGATTCCAGCTCACTG -3'
(R):5'- ATCCATTTGACCTGCAGATTCAG -3'

Sequencing Primer
(F):5'- CTGCTATAGCTCCTAGGAAG -3'
(R):5'- CAGATTCAGGGAGGCTGTGCTC -3'
Posted On 2021-01-18