Incidental Mutation 'R8479:Ddx1'
ID657439
Institutional Source Beutler Lab
Gene Symbol Ddx1
Ensembl Gene ENSMUSG00000037149
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8479 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location13216973-13249213 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13220748 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 654 (N654I)
Ref Sequence ENSEMBL: ENSMUSP00000065987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071103]
Predicted Effect probably damaging
Transcript: ENSMUST00000071103
AA Change: N654I

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065987
Gene: ENSMUSG00000037149
AA Change: N654I

DomainStartEndE-ValueType
DEXDc 21 444 1.95e-47 SMART
SPRY 130 246 1.91e-34 SMART
HELICc 520 610 8.28e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein of unknown function. It shows high transcription levels in 2 retinoblastoma cell lines and in tissues of neuroectodermal origin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,227,860 H241Y probably benign Het
Afg3l2 C T 18: 67,448,916 G29D probably benign Het
Ano2 T C 6: 125,712,160 S52P possibly damaging Het
Atp11a A T 8: 12,842,932 E641V possibly damaging Het
Atp6v1d T C 12: 78,849,746 T116A probably benign Het
BC025446 A G 15: 75,217,777 T45A probably damaging Het
Cacna2d2 T C 9: 107,526,397 probably null Het
Cd109 T A 9: 78,667,346 Y537* probably null Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Cntnap2 C T 6: 46,759,773 A711V probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Crhbp A G 13: 95,442,124 V163A possibly damaging Het
Crmp1 C A 5: 37,284,158 P414Q possibly damaging Het
Cse1l G A 2: 166,921,973 E78K possibly damaging Het
Ctnna2 A G 6: 77,758,590 V35A probably damaging Het
Dgcr14 T C 16: 17,910,941 probably null Het
Dido1 A T 2: 180,673,229 probably null Het
Dmtf1 C T 5: 9,120,428 V630I probably damaging Het
Ercc6 T C 14: 32,526,406 S305P probably benign Het
Ercc6l2 T A 13: 63,824,815 S37T possibly damaging Het
Fnip2 A G 3: 79,512,555 M138T probably damaging Het
Galnt9 T C 5: 110,544,751 V17A probably benign Het
Gm7324 T C 14: 43,714,763 S288P probably benign Het
Gucy2e G A 11: 69,232,963 A370V probably benign Het
H2-Bl G A 17: 36,084,219 A2V probably damaging Het
Ift57 T C 16: 49,701,900 F2L probably damaging Het
Ipo7 G A 7: 110,039,245 V240I probably benign Het
Lrrc4c A G 2: 97,629,632 Y201C probably damaging Het
Mapkap1 A T 2: 34,581,290 S389C probably damaging Het
Met G T 6: 17,491,747 probably null Het
Misp T C 10: 79,827,916 F575L possibly damaging Het
Mtmr11 T C 3: 96,163,734 L136P probably damaging Het
Muc4 C T 16: 32,753,508 T1128M possibly damaging Het
Nfyc A T 4: 120,768,892 V70E probably damaging Het
Nphp4 T C 4: 152,524,290 S452P probably benign Het
Oasl2 T A 5: 114,897,791 F43I probably damaging Het
Olfr1002 A G 2: 85,648,103 S73P probably damaging Het
Olfr1333 A G 4: 118,830,015 C141R probably damaging Het
Pros1 G T 16: 62,907,739 G269W probably damaging Het
Rif1 A C 2: 52,112,551 S2006R possibly damaging Het
Ror2 G T 13: 53,117,364 N306K probably damaging Het
Rragd C T 4: 33,018,734 A379V probably benign Het
Slc10a2 C T 8: 5,098,443 probably null Het
Susd3 C T 13: 49,237,476 G113S probably benign Het
Tbc1d19 T A 5: 53,883,689 M371K possibly damaging Het
Tnn C A 1: 160,122,827 R736S probably benign Het
Trio T C 15: 27,901,200 T323A probably benign Het
Ubqln1 G A 13: 58,191,839 P324S probably benign Het
Uspl1 T C 5: 149,215,194 L1068P probably damaging Het
Vmn2r86 A T 10: 130,446,866 I627N probably damaging Het
Wdr35 C A 12: 8,985,985 T252K probably benign Het
Zfp62 T C 11: 49,216,492 I470T probably damaging Het
Other mutations in Ddx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Ddx1 APN 12 13227459 splice site probably benign
IGL00725:Ddx1 APN 12 13245690 missense probably damaging 1.00
IGL00958:Ddx1 APN 12 13240848 splice site probably null
IGL01786:Ddx1 APN 12 13229136 missense probably benign
IGL02832:Ddx1 APN 12 13227317 nonsense probably null
IGL02983:Ddx1 APN 12 13223862 missense probably damaging 1.00
R0201:Ddx1 UTSW 12 13223808 missense probably damaging 1.00
R0931:Ddx1 UTSW 12 13237817 splice site probably benign
R1434:Ddx1 UTSW 12 13237231 missense probably benign 0.01
R1558:Ddx1 UTSW 12 13239541 missense probably damaging 1.00
R1673:Ddx1 UTSW 12 13244966 critical splice donor site probably null
R1854:Ddx1 UTSW 12 13229331 missense probably benign 0.19
R2910:Ddx1 UTSW 12 13231440 splice site probably null
R2911:Ddx1 UTSW 12 13231440 splice site probably null
R4181:Ddx1 UTSW 12 13231503 nonsense probably null
R4182:Ddx1 UTSW 12 13231503 nonsense probably null
R4183:Ddx1 UTSW 12 13231503 nonsense probably null
R4231:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4234:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4235:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4243:Ddx1 UTSW 12 13240909 nonsense probably null
R4717:Ddx1 UTSW 12 13240887 missense probably damaging 1.00
R4821:Ddx1 UTSW 12 13239147 missense probably damaging 1.00
R5032:Ddx1 UTSW 12 13223992 missense probably damaging 1.00
R5082:Ddx1 UTSW 12 13220435 nonsense probably null
R5528:Ddx1 UTSW 12 13229294 missense probably damaging 1.00
R5997:Ddx1 UTSW 12 13237799 missense probably damaging 1.00
R6398:Ddx1 UTSW 12 13245720 missense probably damaging 1.00
R6891:Ddx1 UTSW 12 13236095 missense probably benign 0.25
R7085:Ddx1 UTSW 12 13229355 missense probably damaging 1.00
R7125:Ddx1 UTSW 12 13243863 missense probably benign 0.18
R7307:Ddx1 UTSW 12 13223959 missense probably damaging 1.00
R7388:Ddx1 UTSW 12 13225455 missense probably null 1.00
R7393:Ddx1 UTSW 12 13230353 missense probably benign 0.03
R7460:Ddx1 UTSW 12 13231439 splice site probably null
R8310:Ddx1 UTSW 12 13224279 intron probably benign
X0011:Ddx1 UTSW 12 13229415 missense probably damaging 1.00
X0028:Ddx1 UTSW 12 13243866 missense probably benign 0.00
Z1177:Ddx1 UTSW 12 13229259 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CGTAATATACATGGAGGCTAGATCC -3'
(R):5'- GCTCTGTAGTAAAGCTTTAGGTCAG -3'

Sequencing Primer
(F):5'- GCTAGATCCCTGGAAGTCAAGTC -3'
(R):5'- TAGTAAAGCTTTAGGTCAGGCATG -3'
Posted On2021-01-18