Mutagenetix > Incidental Mutation

Incidental Mutation 'R8479:Ercc6'

657446

Institutional Source

Beutler Lab

Gene Symbol

Ercc6

Ensembl Gene

ENSMUSG00000054051

Gene Name

excision repair cross-complementing rodent repair deficiency, complementation group 6

Synonyms

CS group B correcting gene, C130058G22Rik, CSB

MMRRC Submission

067923-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.576) question?

Stock #

R8479 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32513521-32580990 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32526406 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 305 (S305P)

Ref Sequence

ENSEMBL: ENSMUSP00000066256 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066807]

AlphaFold

F8VPZ5

Predicted Effect

probably benign
Transcript: ENSMUST00000066807
AA Change: S305P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000066256
Gene: ENSMUSG00000054051
AA Change: S305P

Domain	Start	End	E-Value	Type
PDB:4CVO\|A	82	160	1e-36	PDB
low complexity region	286	299	N/A	INTRINSIC
low complexity region	361	390	N/A	INTRINSIC
low complexity region	422	434	N/A	INTRINSIC
low complexity region	460	469	N/A	INTRINSIC
low complexity region	479	491	N/A	INTRINSIC
DEXDc	499	699	8.34e-33	SMART
Blast:DEXDc	720	821	7e-56	BLAST
HELICc	865	948	1.41e-21	SMART
low complexity region	1364	1377	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein that is important in transcription-coupled excision repair. The encoded protein has ATP-stimulated ATPase activity, interacts with several transcription and excision repair proteins, and may promote complex formation at DNA repair sites. Mutations in this gene are associated with Cockayne syndrome type B and cerebrooculofacioskeletal syndrome 1. Alternative splicing occurs between a splice site from exon 5 of this gene to the 3' splice site upstream of the open reading frame (ORF) of the adjacent gene, piggyback-derived-3 (GeneID:267004), which activates the alternative polyadenylation site downstream of the piggyback-derived-3 ORF. The resulting transcripts encode a fusion protein that shares sequence with the product of each individual gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice exhibit UV sensitivity, inactivation of transcription-coupled repair, increased incidence of induced skin and eye tumors, circling behavior, impaired coordination and lower body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4galt	G	A	15: 83,227,860	H241Y	probably benign	Het
Afg3l2	C	T	18: 67,448,916	G29D	probably benign	Het
Ano2	T	C	6: 125,712,160	S52P	possibly damaging	Het
Atp11a	A	T	8: 12,842,932	E641V	possibly damaging	Het
Atp6v1d	T	C	12: 78,849,746	T116A	probably benign	Het
BC025446	A	G	15: 75,217,777	T45A	probably damaging	Het
Cacna2d2	T	C	9: 107,526,397		probably null	Het
Cd109	T	A	9: 78,667,346	Y537*	probably null	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Celsr2	T	A	3: 108,398,902	T2029S	probably benign	Het
Cntnap2	C	T	6: 46,759,773	A711V	probably benign	Het
Col18a1	T	C	10: 77,081,154	I114V	unknown	Het
Crhbp	A	G	13: 95,442,124	V163A	possibly damaging	Het
Crmp1	C	A	5: 37,284,158	P414Q	possibly damaging	Het
Cse1l	G	A	2: 166,921,973	E78K	possibly damaging	Het
Ctnna2	A	G	6: 77,758,590	V35A	probably damaging	Het
Ddx1	T	A	12: 13,220,748	N654I	probably damaging	Het
Dgcr14	T	C	16: 17,910,941		probably null	Het
Dido1	A	T	2: 180,673,229		probably null	Het
Dmtf1	C	T	5: 9,120,428	V630I	probably damaging	Het
Ercc6l2	T	A	13: 63,824,815	S37T	possibly damaging	Het
Fnip2	A	G	3: 79,512,555	M138T	probably damaging	Het
Galnt9	T	C	5: 110,544,751	V17A	probably benign	Het
Gm7324	T	C	14: 43,714,763	S288P	probably benign	Het
Gucy2e	G	A	11: 69,232,963	A370V	probably benign	Het
H2-Bl	G	A	17: 36,084,219	A2V	probably damaging	Het
Ift57	T	C	16: 49,701,900	F2L	probably damaging	Het
Ipo7	G	A	7: 110,039,245	V240I	probably benign	Het
Lrrc4c	A	G	2: 97,629,632	Y201C	probably damaging	Het
Mapkap1	A	T	2: 34,581,290	S389C	probably damaging	Het
Met	G	T	6: 17,491,747		probably null	Het
Misp	T	C	10: 79,827,916	F575L	possibly damaging	Het
Mtmr11	T	C	3: 96,163,734	L136P	probably damaging	Het
Muc4	C	T	16: 32,753,508	T1128M	possibly damaging	Het
Nfyc	A	T	4: 120,768,892	V70E	probably damaging	Het
Nphp4	T	C	4: 152,524,290	S452P	probably benign	Het
Oasl2	T	A	5: 114,897,791	F43I	probably damaging	Het
Olfr1002	A	G	2: 85,648,103	S73P	probably damaging	Het
Olfr1333	A	G	4: 118,830,015	C141R	probably damaging	Het
Pros1	G	T	16: 62,907,739	G269W	probably damaging	Het
Rif1	A	C	2: 52,112,551	S2006R	possibly damaging	Het
Ror2	G	T	13: 53,117,364	N306K	probably damaging	Het
Rragd	C	T	4: 33,018,734	A379V	probably benign	Het
Slc10a2	C	T	8: 5,098,443		probably null	Het
Susd3	C	T	13: 49,237,476	G113S	probably benign	Het
Tbc1d19	T	A	5: 53,883,689	M371K	possibly damaging	Het
Tnn	C	A	1: 160,122,827	R736S	probably benign	Het
Trio	T	C	15: 27,901,200	T323A	probably benign	Het
Ubqln1	G	A	13: 58,191,839	P324S	probably benign	Het
Uspl1	T	C	5: 149,215,194	L1068P	probably damaging	Het
Vmn2r86	A	T	10: 130,446,866	I627N	probably damaging	Het
Wdr35	C	A	12: 8,985,985	T252K	probably benign	Het
Zfp62	T	C	11: 49,216,492	I470T	probably damaging	Het

Other mutations in Ercc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Ercc6	APN	14	32568072	missense	probably damaging	1.00
IGL00796:Ercc6	APN	14	32570002	missense	probably benign	0.01
IGL00916:Ercc6	APN	14	32562655	intron	probably benign
IGL01743:Ercc6	APN	14	32552604	missense	probably damaging	1.00
IGL01802:Ercc6	APN	14	32562574	missense	probably damaging	0.99
IGL01886:Ercc6	APN	14	32569580	missense	possibly damaging	0.90
IGL02100:Ercc6	APN	14	32517095	missense	probably benign	0.00
IGL02115:Ercc6	APN	14	32576993	missense	probably damaging	1.00
IGL02755:Ercc6	APN	14	32575748	splice site	probably benign
IGL02964:Ercc6	APN	14	32570103	missense	probably benign	0.00
IGL02998:Ercc6	APN	14	32557857	missense	probably benign	0.05
IGL03150:Ercc6	APN	14	32558574	missense	probably damaging	0.96
R0152:Ercc6	UTSW	14	32546905	critical splice donor site	probably benign
R0519:Ercc6	UTSW	14	32526842	missense	probably damaging	1.00
R0591:Ercc6	UTSW	14	32558016	splice site	probably benign
R0894:Ercc6	UTSW	14	32517028	missense	probably benign	0.05
R0946:Ercc6	UTSW	14	32552621	missense	probably benign	0.08
R1313:Ercc6	UTSW	14	32552720	splice site	probably benign
R1506:Ercc6	UTSW	14	32569864	missense	probably benign	0.01
R1528:Ercc6	UTSW	14	32519022	missense	probably damaging	0.98
R1711:Ercc6	UTSW	14	32526176	missense	probably damaging	1.00
R1753:Ercc6	UTSW	14	32576999	missense	probably benign
R1795:Ercc6	UTSW	14	32517028	missense	probably benign	0.05
R1843:Ercc6	UTSW	14	32546820	missense	probably damaging	0.99
R1853:Ercc6	UTSW	14	32576816	missense	possibly damaging	0.86
R1859:Ercc6	UTSW	14	32526778	missense	probably damaging	1.00
R1912:Ercc6	UTSW	14	32576803	missense	probably damaging	1.00
R2308:Ercc6	UTSW	14	32566409	missense	possibly damaging	0.70
R2322:Ercc6	UTSW	14	32526317	missense	probably damaging	1.00
R2386:Ercc6	UTSW	14	32541359	splice site	probably null
R4170:Ercc6	UTSW	14	32566797	missense	probably damaging	1.00
R4369:Ercc6	UTSW	14	32517207	missense	probably damaging	0.96
R4389:Ercc6	UTSW	14	32574908	nonsense	probably null
R4747:Ercc6	UTSW	14	32569907	missense	probably benign	0.00
R4811:Ercc6	UTSW	14	32574929	missense	probably benign	0.20
R4840:Ercc6	UTSW	14	32541296	missense	probably damaging	1.00
R4973:Ercc6	UTSW	14	32574902	missense	probably damaging	1.00
R5068:Ercc6	UTSW	14	32570063	missense	probably benign	0.01
R5069:Ercc6	UTSW	14	32570063	missense	probably benign	0.01
R5070:Ercc6	UTSW	14	32570063	missense	probably benign	0.01
R5093:Ercc6	UTSW	14	32567522	missense	probably damaging	1.00
R5265:Ercc6	UTSW	14	32569623	missense	probably benign	0.01
R5272:Ercc6	UTSW	14	32519028	nonsense	probably null
R5499:Ercc6	UTSW	14	32516959	start codon destroyed	probably null	0.98
R5795:Ercc6	UTSW	14	32526352	missense	probably damaging	0.98
R6258:Ercc6	UTSW	14	32557856	missense	probably benign	0.00
R6260:Ercc6	UTSW	14	32557856	missense	probably benign	0.00
R6267:Ercc6	UTSW	14	32526403	nonsense	probably null
R6291:Ercc6	UTSW	14	32569986	missense	probably benign	0.01
R6296:Ercc6	UTSW	14	32526403	nonsense	probably null
R6361:Ercc6	UTSW	14	32517110	missense	probably benign	0.00
R6500:Ercc6	UTSW	14	32526823	missense	probably damaging	0.96
R6555:Ercc6	UTSW	14	32517107	missense	probably benign	0.15
R6724:Ercc6	UTSW	14	32566331	missense	probably benign	0.01
R6925:Ercc6	UTSW	14	32562608	missense	probably damaging	0.99
R7143:Ercc6	UTSW	14	32570305	missense	probably damaging	1.00
R7327:Ercc6	UTSW	14	32526404	missense	probably benign	0.19
R7396:Ercc6	UTSW	14	32569805	missense	probably benign	0.00
R7529:Ercc6	UTSW	14	32560729	nonsense	probably null
R7609:Ercc6	UTSW	14	32566361	missense	probably benign	0.11
R7802:Ercc6	UTSW	14	32517303	missense	probably damaging	1.00
R7854:Ercc6	UTSW	14	32566292	missense	probably damaging	1.00
R7995:Ercc6	UTSW	14	32562569	missense	probably damaging	0.99
R8181:Ercc6	UTSW	14	32557948	missense	probably damaging	1.00
R8320:Ercc6	UTSW	14	32521015	missense	probably benign	0.01
R8388:Ercc6	UTSW	14	32570340	utr 3 prime	probably benign
R8831:Ercc6	UTSW	14	32560827	critical splice donor site	probably null
R8849:Ercc6	UTSW	14	32569608	missense	probably damaging	1.00
R8912:Ercc6	UTSW	14	32526254	missense	probably benign	0.40
R9210:Ercc6	UTSW	14	32569865	missense	probably benign	0.00
R9309:Ercc6	UTSW	14	32518947	missense	probably damaging	1.00
R9499:Ercc6	UTSW	14	32562568	missense	probably damaging	1.00
R9552:Ercc6	UTSW	14	32562568	missense	probably damaging	1.00
R9562:Ercc6	UTSW	14	32574967	missense	probably damaging	1.00
R9688:Ercc6	UTSW	14	32575798	missense	probably benign
R9699:Ercc6	UTSW	14	32560746	missense	probably damaging	1.00
R9743:Ercc6	UTSW	14	32576986	missense	probably benign	0.01
Z1176:Ercc6	UTSW	14	32526487	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- TGGCCAGATGACACCGTTTG -3'
(R):5'- TAGCTAACGTCATCAGAAGACAGG -3'

Sequencing Primer
(F):5'- CGTTTGGTACCCCAGCC -3'
(R):5'- TCATCAGAAGACAGGCTGGCTAC -3'

Posted On

2021-01-18