Incidental Mutation 'R8479:BC025446'
ID 657449
Institutional Source Beutler Lab
Gene Symbol BC025446
Ensembl Gene ENSMUSG00000047728
Gene Name cDNA sequence BC025446
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8479 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 75216376-75222661 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75217777 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 45 (T45A)
Ref Sequence ENSEMBL: ENSMUSP00000053396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055719] [ENSMUST00000185307] [ENSMUST00000229521]
AlphaFold A0A087WQT1
Predicted Effect probably damaging
Transcript: ENSMUST00000055719
AA Change: T45A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053396
Gene: ENSMUSG00000047728
AA Change: T45A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 1.06e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185307
AA Change: T45A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140330
Gene: ENSMUSG00000047728
AA Change: T45A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 5.3e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229521
AA Change: T45A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,227,860 H241Y probably benign Het
Afg3l2 C T 18: 67,448,916 G29D probably benign Het
Ano2 T C 6: 125,712,160 S52P possibly damaging Het
Atp11a A T 8: 12,842,932 E641V possibly damaging Het
Atp6v1d T C 12: 78,849,746 T116A probably benign Het
Cacna2d2 T C 9: 107,526,397 probably null Het
Cd109 T A 9: 78,667,346 Y537* probably null Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Cntnap2 C T 6: 46,759,773 A711V probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Crhbp A G 13: 95,442,124 V163A possibly damaging Het
Crmp1 C A 5: 37,284,158 P414Q possibly damaging Het
Cse1l G A 2: 166,921,973 E78K possibly damaging Het
Ctnna2 A G 6: 77,758,590 V35A probably damaging Het
Ddx1 T A 12: 13,220,748 N654I probably damaging Het
Dgcr14 T C 16: 17,910,941 probably null Het
Dido1 A T 2: 180,673,229 probably null Het
Dmtf1 C T 5: 9,120,428 V630I probably damaging Het
Ercc6 T C 14: 32,526,406 S305P probably benign Het
Ercc6l2 T A 13: 63,824,815 S37T possibly damaging Het
Fnip2 A G 3: 79,512,555 M138T probably damaging Het
Galnt9 T C 5: 110,544,751 V17A probably benign Het
Gm7324 T C 14: 43,714,763 S288P probably benign Het
Gucy2e G A 11: 69,232,963 A370V probably benign Het
H2-Bl G A 17: 36,084,219 A2V probably damaging Het
Ift57 T C 16: 49,701,900 F2L probably damaging Het
Ipo7 G A 7: 110,039,245 V240I probably benign Het
Lrrc4c A G 2: 97,629,632 Y201C probably damaging Het
Mapkap1 A T 2: 34,581,290 S389C probably damaging Het
Met G T 6: 17,491,747 probably null Het
Misp T C 10: 79,827,916 F575L possibly damaging Het
Mtmr11 T C 3: 96,163,734 L136P probably damaging Het
Muc4 C T 16: 32,753,508 T1128M possibly damaging Het
Nfyc A T 4: 120,768,892 V70E probably damaging Het
Nphp4 T C 4: 152,524,290 S452P probably benign Het
Oasl2 T A 5: 114,897,791 F43I probably damaging Het
Olfr1002 A G 2: 85,648,103 S73P probably damaging Het
Olfr1333 A G 4: 118,830,015 C141R probably damaging Het
Pros1 G T 16: 62,907,739 G269W probably damaging Het
Rif1 A C 2: 52,112,551 S2006R possibly damaging Het
Ror2 G T 13: 53,117,364 N306K probably damaging Het
Rragd C T 4: 33,018,734 A379V probably benign Het
Slc10a2 C T 8: 5,098,443 probably null Het
Susd3 C T 13: 49,237,476 G113S probably benign Het
Tbc1d19 T A 5: 53,883,689 M371K possibly damaging Het
Tnn C A 1: 160,122,827 R736S probably benign Het
Trio T C 15: 27,901,200 T323A probably benign Het
Ubqln1 G A 13: 58,191,839 P324S probably benign Het
Uspl1 T C 5: 149,215,194 L1068P probably damaging Het
Vmn2r86 A T 10: 130,446,866 I627N probably damaging Het
Wdr35 C A 12: 8,985,985 T252K probably benign Het
Zfp62 T C 11: 49,216,492 I470T probably damaging Het
Other mutations in BC025446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:BC025446 APN 15 75221656 utr 3 prime probably benign
R0084:BC025446 UTSW 15 75217775 missense probably benign 0.01
R0764:BC025446 UTSW 15 75220723 missense probably benign
R1736:BC025446 UTSW 15 75217720 missense probably damaging 1.00
R1829:BC025446 UTSW 15 75216756 critical splice donor site probably null
R5412:BC025446 UTSW 15 75217820 missense probably damaging 0.98
R5793:BC025446 UTSW 15 75221644 utr 3 prime probably benign
R7434:BC025446 UTSW 15 75216718 missense probably benign
R8007:BC025446 UTSW 15 75216703 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGGCAGCAATGTCCTTG -3'
(R):5'- ATTTCAGCACATCCCTGGAC -3'

Sequencing Primer
(F):5'- GCTCTGTTCTAGTGGCCAGC -3'
(R):5'- ACATTGCAGGAGTCTCACTTCAATC -3'
Posted On 2021-01-18