Incidental Mutation 'R8479:Pros1'
ID 657454
Institutional Source Beutler Lab
Gene Symbol Pros1
Ensembl Gene ENSMUSG00000022912
Gene Name protein S (alpha)
Synonyms protein S
MMRRC Submission
Accession Numbers

Genbank: NM_011173; MGI: 1095733  

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8479 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 62854307-62929346 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 62907739 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 269 (G269W)
Ref Sequence ENSEMBL: ENSMUSP00000023629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023629]
AlphaFold Q08761
Predicted Effect probably damaging
Transcript: ENSMUST00000023629
AA Change: G269W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: G269W

DomainStartEndE-ValueType
GLA 23 86 3.63e-31 SMART
EGF 120 155 4.39e-2 SMART
EGF_CA 157 200 6.91e-9 SMART
EGF_CA 201 242 5.23e-9 SMART
EGF_CA 243 283 1.1e-7 SMART
LamG 321 458 8.55e-22 SMART
LamG 506 646 1.57e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,227,860 H241Y probably benign Het
Afg3l2 C T 18: 67,448,916 G29D probably benign Het
Ano2 T C 6: 125,712,160 S52P possibly damaging Het
Atp11a A T 8: 12,842,932 E641V possibly damaging Het
Atp6v1d T C 12: 78,849,746 T116A probably benign Het
BC025446 A G 15: 75,217,777 T45A probably damaging Het
Cacna2d2 T C 9: 107,526,397 probably null Het
Cd109 T A 9: 78,667,346 Y537* probably null Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Cntnap2 C T 6: 46,759,773 A711V probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Crhbp A G 13: 95,442,124 V163A possibly damaging Het
Crmp1 C A 5: 37,284,158 P414Q possibly damaging Het
Cse1l G A 2: 166,921,973 E78K possibly damaging Het
Ctnna2 A G 6: 77,758,590 V35A probably damaging Het
Ddx1 T A 12: 13,220,748 N654I probably damaging Het
Dgcr14 T C 16: 17,910,941 probably null Het
Dido1 A T 2: 180,673,229 probably null Het
Dmtf1 C T 5: 9,120,428 V630I probably damaging Het
Ercc6 T C 14: 32,526,406 S305P probably benign Het
Ercc6l2 T A 13: 63,824,815 S37T possibly damaging Het
Fnip2 A G 3: 79,512,555 M138T probably damaging Het
Galnt9 T C 5: 110,544,751 V17A probably benign Het
Gm7324 T C 14: 43,714,763 S288P probably benign Het
Gucy2e G A 11: 69,232,963 A370V probably benign Het
H2-Bl G A 17: 36,084,219 A2V probably damaging Het
Ift57 T C 16: 49,701,900 F2L probably damaging Het
Ipo7 G A 7: 110,039,245 V240I probably benign Het
Lrrc4c A G 2: 97,629,632 Y201C probably damaging Het
Mapkap1 A T 2: 34,581,290 S389C probably damaging Het
Met G T 6: 17,491,747 probably null Het
Misp T C 10: 79,827,916 F575L possibly damaging Het
Mtmr11 T C 3: 96,163,734 L136P probably damaging Het
Muc4 C T 16: 32,753,508 T1128M possibly damaging Het
Nfyc A T 4: 120,768,892 V70E probably damaging Het
Nphp4 T C 4: 152,524,290 S452P probably benign Het
Oasl2 T A 5: 114,897,791 F43I probably damaging Het
Olfr1002 A G 2: 85,648,103 S73P probably damaging Het
Olfr1333 A G 4: 118,830,015 C141R probably damaging Het
Rif1 A C 2: 52,112,551 S2006R possibly damaging Het
Ror2 G T 13: 53,117,364 N306K probably damaging Het
Rragd C T 4: 33,018,734 A379V probably benign Het
Slc10a2 C T 8: 5,098,443 probably null Het
Susd3 C T 13: 49,237,476 G113S probably benign Het
Tbc1d19 T A 5: 53,883,689 M371K possibly damaging Het
Tnn C A 1: 160,122,827 R736S probably benign Het
Trio T C 15: 27,901,200 T323A probably benign Het
Ubqln1 G A 13: 58,191,839 P324S probably benign Het
Uspl1 T C 5: 149,215,194 L1068P probably damaging Het
Vmn2r86 A T 10: 130,446,866 I627N probably damaging Het
Wdr35 C A 12: 8,985,985 T252K probably benign Het
Zfp62 T C 11: 49,216,492 I470T probably damaging Het
Other mutations in Pros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Pros1 APN 16 62910045 missense probably damaging 0.99
IGL01300:Pros1 APN 16 62913811 missense possibly damaging 0.85
IGL02709:Pros1 APN 16 62898945 missense probably damaging 0.99
IGL03080:Pros1 APN 16 62918143 missense probably damaging 0.98
IGL03095:Pros1 APN 16 62907769 nonsense probably null
F6893:Pros1 UTSW 16 62924639 missense probably damaging 0.98
R0124:Pros1 UTSW 16 62913946 missense possibly damaging 0.95
R0517:Pros1 UTSW 16 62903518 missense probably benign 0.03
R1113:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1308:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1355:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1370:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1517:Pros1 UTSW 16 62885512 missense probably damaging 0.98
R1866:Pros1 UTSW 16 62928135 missense possibly damaging 0.86
R1876:Pros1 UTSW 16 62903518 missense probably damaging 0.96
R2255:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R2364:Pros1 UTSW 16 62913848 missense probably damaging 0.99
R2369:Pros1 UTSW 16 62928069 missense probably damaging 1.00
R2979:Pros1 UTSW 16 62913866 missense probably damaging 0.99
R3724:Pros1 UTSW 16 62900329 missense possibly damaging 0.86
R4056:Pros1 UTSW 16 62900645 nonsense probably null
R4556:Pros1 UTSW 16 62900673 missense possibly damaging 0.95
R4688:Pros1 UTSW 16 62889007 critical splice donor site probably null
R4850:Pros1 UTSW 16 62885524 missense probably damaging 0.98
R4923:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R5008:Pros1 UTSW 16 62928185 missense possibly damaging 0.53
R5370:Pros1 UTSW 16 62913976 missense probably benign 0.01
R5580:Pros1 UTSW 16 62926326 critical splice acceptor site probably null
R5930:Pros1 UTSW 16 62928061 missense probably damaging 0.96
R5974:Pros1 UTSW 16 62900667 missense probably damaging 0.98
R6233:Pros1 UTSW 16 62898921 missense possibly damaging 0.47
R6949:Pros1 UTSW 16 62924575 missense probably benign 0.01
R7055:Pros1 UTSW 16 62928102 missense possibly damaging 0.85
R7347:Pros1 UTSW 16 62919523 missense probably damaging 0.97
R7375:Pros1 UTSW 16 62924550 missense probably damaging 0.96
R7419:Pros1 UTSW 16 62928070 nonsense probably null
R7980:Pros1 UTSW 16 62928153 missense possibly damaging 0.86
R8234:Pros1 UTSW 16 62928177 missense possibly damaging 0.73
R8514:Pros1 UTSW 16 62910109 missense probably benign 0.03
R8827:Pros1 UTSW 16 62926464 missense probably benign 0.13
R9131:Pros1 UTSW 16 62928034 missense probably damaging 0.96
R9484:Pros1 UTSW 16 62924524 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATGCTGTCATGGCTACTCTG -3'
(R):5'- ACAGAGCAGAAGTTTGTTTGGG -3'

Sequencing Primer
(F):5'- CATGGCTACTCTGTTTTCTAAGAAAC -3'
(R):5'- CCCTGGCTGACCTGAAACTC -3'
Posted On 2021-01-18