Incidental Mutation 'R8479:Pros1'
ID 657454
Institutional Source Beutler Lab
Gene Symbol Pros1
Ensembl Gene ENSMUSG00000022912
Gene Name protein S (alpha)
Synonyms protein S
MMRRC Submission 067923-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8479 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 62674670-62749709 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 62728102 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 269 (G269W)
Ref Sequence ENSEMBL: ENSMUSP00000023629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023629]
AlphaFold Q08761
Predicted Effect probably damaging
Transcript: ENSMUST00000023629
AA Change: G269W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: G269W

DomainStartEndE-ValueType
GLA 23 86 3.63e-31 SMART
EGF 120 155 4.39e-2 SMART
EGF_CA 157 200 6.91e-9 SMART
EGF_CA 201 242 5.23e-9 SMART
EGF_CA 243 283 1.1e-7 SMART
LamG 321 458 8.55e-22 SMART
LamG 506 646 1.57e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,112,061 (GRCm39) H241Y probably benign Het
Afg3l2 C T 18: 67,581,986 (GRCm39) G29D probably benign Het
Ano2 T C 6: 125,689,123 (GRCm39) S52P possibly damaging Het
Atp11a A T 8: 12,892,932 (GRCm39) E641V possibly damaging Het
Atp6v1d T C 12: 78,896,520 (GRCm39) T116A probably benign Het
Cacna2d2 T C 9: 107,403,596 (GRCm39) probably null Het
Cd109 T A 9: 78,574,628 (GRCm39) Y537* probably null Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Cntnap2 C T 6: 46,736,707 (GRCm39) A711V probably benign Het
Col18a1 T C 10: 76,916,988 (GRCm39) I114V unknown Het
Crhbp A G 13: 95,578,632 (GRCm39) V163A possibly damaging Het
Crmp1 C A 5: 37,441,502 (GRCm39) P414Q possibly damaging Het
Cse1l G A 2: 166,763,893 (GRCm39) E78K possibly damaging Het
Ctnna2 A G 6: 77,735,573 (GRCm39) V35A probably damaging Het
Ddx1 T A 12: 13,270,749 (GRCm39) N654I probably damaging Het
Dido1 A T 2: 180,315,022 (GRCm39) probably null Het
Dmtf1 C T 5: 9,170,428 (GRCm39) V630I probably damaging Het
Ercc6 T C 14: 32,248,363 (GRCm39) S305P probably benign Het
Ercc6l2 T A 13: 63,972,629 (GRCm39) S37T possibly damaging Het
Ess2 T C 16: 17,728,805 (GRCm39) probably null Het
Fnip2 A G 3: 79,419,862 (GRCm39) M138T probably damaging Het
Galnt9 T C 5: 110,692,617 (GRCm39) V17A probably benign Het
Gm7324 T C 14: 43,952,220 (GRCm39) S288P probably benign Het
Gucy2e G A 11: 69,123,789 (GRCm39) A370V probably benign Het
H2-T13 G A 17: 36,395,111 (GRCm39) A2V probably damaging Het
Ift57 T C 16: 49,522,263 (GRCm39) F2L probably damaging Het
Ipo7 G A 7: 109,638,452 (GRCm39) V240I probably benign Het
Lrrc4c A G 2: 97,459,977 (GRCm39) Y201C probably damaging Het
Ly6g2 A G 15: 75,089,626 (GRCm39) T45A probably damaging Het
Mapkap1 A T 2: 34,471,302 (GRCm39) S389C probably damaging Het
Met G T 6: 17,491,746 (GRCm39) probably null Het
Misp T C 10: 79,663,750 (GRCm39) F575L possibly damaging Het
Mtmr11 T C 3: 96,071,051 (GRCm39) L136P probably damaging Het
Muc4 C T 16: 32,574,799 (GRCm39) T1128M possibly damaging Het
Nfyc A T 4: 120,626,089 (GRCm39) V70E probably damaging Het
Nphp4 T C 4: 152,608,747 (GRCm39) S452P probably benign Het
Oasl2 T A 5: 115,035,852 (GRCm39) F43I probably damaging Het
Or10ak11 A G 4: 118,687,212 (GRCm39) C141R probably damaging Het
Or5g25 A G 2: 85,478,447 (GRCm39) S73P probably damaging Het
Rif1 A C 2: 52,002,563 (GRCm39) S2006R possibly damaging Het
Ror2 G T 13: 53,271,400 (GRCm39) N306K probably damaging Het
Rragd C T 4: 33,018,734 (GRCm39) A379V probably benign Het
Slc10a2 C T 8: 5,148,443 (GRCm39) probably null Het
Susd3 C T 13: 49,390,952 (GRCm39) G113S probably benign Het
Tbc1d19 T A 5: 54,041,031 (GRCm39) M371K possibly damaging Het
Tnn C A 1: 159,950,397 (GRCm39) R736S probably benign Het
Trio T C 15: 27,901,286 (GRCm39) T323A probably benign Het
Ubqln1 G A 13: 58,339,653 (GRCm39) P324S probably benign Het
Uspl1 T C 5: 149,152,004 (GRCm39) L1068P probably damaging Het
Vmn2r86 A T 10: 130,282,735 (GRCm39) I627N probably damaging Het
Wdr35 C A 12: 9,035,985 (GRCm39) T252K probably benign Het
Zfp62 T C 11: 49,107,319 (GRCm39) I470T probably damaging Het
Other mutations in Pros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Pros1 APN 16 62,730,408 (GRCm39) missense probably damaging 0.99
IGL01300:Pros1 APN 16 62,734,174 (GRCm39) missense possibly damaging 0.85
IGL02709:Pros1 APN 16 62,719,308 (GRCm39) missense probably damaging 0.99
IGL03080:Pros1 APN 16 62,738,506 (GRCm39) missense probably damaging 0.98
IGL03095:Pros1 APN 16 62,728,132 (GRCm39) nonsense probably null
F6893:Pros1 UTSW 16 62,745,002 (GRCm39) missense probably damaging 0.98
R0124:Pros1 UTSW 16 62,734,309 (GRCm39) missense possibly damaging 0.95
R0517:Pros1 UTSW 16 62,723,881 (GRCm39) missense probably benign 0.03
R1113:Pros1 UTSW 16 62,734,228 (GRCm39) missense probably damaging 0.99
R1308:Pros1 UTSW 16 62,734,228 (GRCm39) missense probably damaging 0.99
R1355:Pros1 UTSW 16 62,739,921 (GRCm39) missense probably benign 0.23
R1370:Pros1 UTSW 16 62,739,921 (GRCm39) missense probably benign 0.23
R1517:Pros1 UTSW 16 62,705,875 (GRCm39) missense probably damaging 0.98
R1866:Pros1 UTSW 16 62,748,498 (GRCm39) missense possibly damaging 0.86
R1876:Pros1 UTSW 16 62,723,881 (GRCm39) missense probably damaging 0.96
R2255:Pros1 UTSW 16 62,723,935 (GRCm39) missense possibly damaging 0.86
R2364:Pros1 UTSW 16 62,734,211 (GRCm39) missense probably damaging 0.99
R2369:Pros1 UTSW 16 62,748,432 (GRCm39) missense probably damaging 1.00
R2979:Pros1 UTSW 16 62,734,229 (GRCm39) missense probably damaging 0.99
R3724:Pros1 UTSW 16 62,720,692 (GRCm39) missense possibly damaging 0.86
R4056:Pros1 UTSW 16 62,721,008 (GRCm39) nonsense probably null
R4556:Pros1 UTSW 16 62,721,036 (GRCm39) missense possibly damaging 0.95
R4688:Pros1 UTSW 16 62,709,370 (GRCm39) critical splice donor site probably null
R4850:Pros1 UTSW 16 62,705,887 (GRCm39) missense probably damaging 0.98
R4923:Pros1 UTSW 16 62,723,935 (GRCm39) missense possibly damaging 0.86
R5008:Pros1 UTSW 16 62,748,548 (GRCm39) missense possibly damaging 0.53
R5370:Pros1 UTSW 16 62,734,339 (GRCm39) missense probably benign 0.01
R5580:Pros1 UTSW 16 62,746,689 (GRCm39) critical splice acceptor site probably null
R5930:Pros1 UTSW 16 62,748,424 (GRCm39) missense probably damaging 0.96
R5974:Pros1 UTSW 16 62,721,030 (GRCm39) missense probably damaging 0.98
R6233:Pros1 UTSW 16 62,719,284 (GRCm39) missense possibly damaging 0.47
R6949:Pros1 UTSW 16 62,744,938 (GRCm39) missense probably benign 0.01
R7055:Pros1 UTSW 16 62,748,465 (GRCm39) missense possibly damaging 0.85
R7347:Pros1 UTSW 16 62,739,886 (GRCm39) missense probably damaging 0.97
R7375:Pros1 UTSW 16 62,744,913 (GRCm39) missense probably damaging 0.96
R7419:Pros1 UTSW 16 62,748,433 (GRCm39) nonsense probably null
R7980:Pros1 UTSW 16 62,748,516 (GRCm39) missense possibly damaging 0.86
R8234:Pros1 UTSW 16 62,748,540 (GRCm39) missense possibly damaging 0.73
R8514:Pros1 UTSW 16 62,730,472 (GRCm39) missense probably benign 0.03
R8827:Pros1 UTSW 16 62,746,827 (GRCm39) missense probably benign 0.13
R9131:Pros1 UTSW 16 62,748,397 (GRCm39) missense probably damaging 0.96
R9484:Pros1 UTSW 16 62,744,887 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATGCTGTCATGGCTACTCTG -3'
(R):5'- ACAGAGCAGAAGTTTGTTTGGG -3'

Sequencing Primer
(F):5'- CATGGCTACTCTGTTTTCTAAGAAAC -3'
(R):5'- CCCTGGCTGACCTGAAACTC -3'
Posted On 2021-01-18