Mutagenetix > Incidental Mutation

Incidental Mutation 'R8479:Pros1'

657454

Institutional Source

Beutler Lab

Gene Symbol

Pros1

Ensembl Gene

ENSMUSG00000022912

Gene Name

protein S (alpha)

Synonyms

protein S

MMRRC Submission

Accession Numbers

Genbank: NM_011173; MGI: 1095733

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8479 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62854307-62929346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 62907739 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Tryptophan at position 269 (G269W)

Ref Sequence

ENSEMBL: ENSMUSP00000023629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023629]

AlphaFold

Q08761

Predicted Effect

probably damaging
Transcript: ENSMUST00000023629
AA Change: G269W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: G269W

Domain	Start	End	E-Value	Type
GLA	23	86	3.63e-31	SMART
EGF	120	155	4.39e-2	SMART
EGF_CA	157	200	6.91e-9	SMART
EGF_CA	201	242	5.23e-9	SMART
EGF_CA	243	283	1.1e-7	SMART
LamG	321	458	8.55e-22	SMART
LamG	506	646	1.57e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4galt	G	A	15: 83,227,860	H241Y	probably benign	Het
Afg3l2	C	T	18: 67,448,916	G29D	probably benign	Het
Ano2	T	C	6: 125,712,160	S52P	possibly damaging	Het
Atp11a	A	T	8: 12,842,932	E641V	possibly damaging	Het
Atp6v1d	T	C	12: 78,849,746	T116A	probably benign	Het
BC025446	A	G	15: 75,217,777	T45A	probably damaging	Het
Cacna2d2	T	C	9: 107,526,397		probably null	Het
Cd109	T	A	9: 78,667,346	Y537*	probably null	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Celsr2	T	A	3: 108,398,902	T2029S	probably benign	Het
Cntnap2	C	T	6: 46,759,773	A711V	probably benign	Het
Col18a1	T	C	10: 77,081,154	I114V	unknown	Het
Crhbp	A	G	13: 95,442,124	V163A	possibly damaging	Het
Crmp1	C	A	5: 37,284,158	P414Q	possibly damaging	Het
Cse1l	G	A	2: 166,921,973	E78K	possibly damaging	Het
Ctnna2	A	G	6: 77,758,590	V35A	probably damaging	Het
Ddx1	T	A	12: 13,220,748	N654I	probably damaging	Het
Dgcr14	T	C	16: 17,910,941		probably null	Het
Dido1	A	T	2: 180,673,229		probably null	Het
Dmtf1	C	T	5: 9,120,428	V630I	probably damaging	Het
Ercc6	T	C	14: 32,526,406	S305P	probably benign	Het
Ercc6l2	T	A	13: 63,824,815	S37T	possibly damaging	Het
Fnip2	A	G	3: 79,512,555	M138T	probably damaging	Het
Galnt9	T	C	5: 110,544,751	V17A	probably benign	Het
Gm7324	T	C	14: 43,714,763	S288P	probably benign	Het
Gucy2e	G	A	11: 69,232,963	A370V	probably benign	Het
H2-Bl	G	A	17: 36,084,219	A2V	probably damaging	Het
Ift57	T	C	16: 49,701,900	F2L	probably damaging	Het
Ipo7	G	A	7: 110,039,245	V240I	probably benign	Het
Lrrc4c	A	G	2: 97,629,632	Y201C	probably damaging	Het
Mapkap1	A	T	2: 34,581,290	S389C	probably damaging	Het
Met	G	T	6: 17,491,747		probably null	Het
Misp	T	C	10: 79,827,916	F575L	possibly damaging	Het
Mtmr11	T	C	3: 96,163,734	L136P	probably damaging	Het
Muc4	C	T	16: 32,753,508	T1128M	possibly damaging	Het
Nfyc	A	T	4: 120,768,892	V70E	probably damaging	Het
Nphp4	T	C	4: 152,524,290	S452P	probably benign	Het
Oasl2	T	A	5: 114,897,791	F43I	probably damaging	Het
Olfr1002	A	G	2: 85,648,103	S73P	probably damaging	Het
Olfr1333	A	G	4: 118,830,015	C141R	probably damaging	Het
Rif1	A	C	2: 52,112,551	S2006R	possibly damaging	Het
Ror2	G	T	13: 53,117,364	N306K	probably damaging	Het
Rragd	C	T	4: 33,018,734	A379V	probably benign	Het
Slc10a2	C	T	8: 5,098,443		probably null	Het
Susd3	C	T	13: 49,237,476	G113S	probably benign	Het
Tbc1d19	T	A	5: 53,883,689	M371K	possibly damaging	Het
Tnn	C	A	1: 160,122,827	R736S	probably benign	Het
Trio	T	C	15: 27,901,200	T323A	probably benign	Het
Ubqln1	G	A	13: 58,191,839	P324S	probably benign	Het
Uspl1	T	C	5: 149,215,194	L1068P	probably damaging	Het
Vmn2r86	A	T	10: 130,446,866	I627N	probably damaging	Het
Wdr35	C	A	12: 8,985,985	T252K	probably benign	Het
Zfp62	T	C	11: 49,216,492	I470T	probably damaging	Het

Other mutations in Pros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Pros1	APN	16	62910045	missense	probably damaging	0.99
IGL01300:Pros1	APN	16	62913811	missense	possibly damaging	0.85
IGL02709:Pros1	APN	16	62898945	missense	probably damaging	0.99
IGL03080:Pros1	APN	16	62918143	missense	probably damaging	0.98
IGL03095:Pros1	APN	16	62907769	nonsense	probably null
F6893:Pros1	UTSW	16	62924639	missense	probably damaging	0.98
R0124:Pros1	UTSW	16	62913946	missense	possibly damaging	0.95
R0517:Pros1	UTSW	16	62903518	missense	probably benign	0.03
R1113:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1308:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1355:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1370:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1517:Pros1	UTSW	16	62885512	missense	probably damaging	0.98
R1866:Pros1	UTSW	16	62928135	missense	possibly damaging	0.86
R1876:Pros1	UTSW	16	62903518	missense	probably damaging	0.96
R2255:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R2364:Pros1	UTSW	16	62913848	missense	probably damaging	0.99
R2369:Pros1	UTSW	16	62928069	missense	probably damaging	1.00
R2979:Pros1	UTSW	16	62913866	missense	probably damaging	0.99
R3724:Pros1	UTSW	16	62900329	missense	possibly damaging	0.86
R4056:Pros1	UTSW	16	62900645	nonsense	probably null
R4556:Pros1	UTSW	16	62900673	missense	possibly damaging	0.95
R4688:Pros1	UTSW	16	62889007	critical splice donor site	probably null
R4850:Pros1	UTSW	16	62885524	missense	probably damaging	0.98
R4923:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R5008:Pros1	UTSW	16	62928185	missense	possibly damaging	0.53
R5370:Pros1	UTSW	16	62913976	missense	probably benign	0.01
R5580:Pros1	UTSW	16	62926326	critical splice acceptor site	probably null
R5930:Pros1	UTSW	16	62928061	missense	probably damaging	0.96
R5974:Pros1	UTSW	16	62900667	missense	probably damaging	0.98
R6233:Pros1	UTSW	16	62898921	missense	possibly damaging	0.47
R6949:Pros1	UTSW	16	62924575	missense	probably benign	0.01
R7055:Pros1	UTSW	16	62928102	missense	possibly damaging	0.85
R7347:Pros1	UTSW	16	62919523	missense	probably damaging	0.97
R7375:Pros1	UTSW	16	62924550	missense	probably damaging	0.96
R7419:Pros1	UTSW	16	62928070	nonsense	probably null
R7980:Pros1	UTSW	16	62928153	missense	possibly damaging	0.86
R8234:Pros1	UTSW	16	62928177	missense	possibly damaging	0.73
R8514:Pros1	UTSW	16	62910109	missense	probably benign	0.03
R8827:Pros1	UTSW	16	62926464	missense	probably benign	0.13
R9131:Pros1	UTSW	16	62928034	missense	probably damaging	0.96
R9484:Pros1	UTSW	16	62924524	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- ATGCTGTCATGGCTACTCTG -3'
(R):5'- ACAGAGCAGAAGTTTGTTTGGG -3'

Sequencing Primer
(F):5'- CATGGCTACTCTGTTTTCTAAGAAAC -3'
(R):5'- CCCTGGCTGACCTGAAACTC -3'

Posted On

2021-01-18