Incidental Mutation 'R8480:Or4f14d'
ID 657458
Institutional Source Beutler Lab
Gene Symbol Or4f14d
Ensembl Gene ENSMUSG00000109801
Gene Name olfactory receptor family 4 subfamily F member 14D
Synonyms MOR245-1, Olfr1316, GA_x6K02T2Q125-73177039-73176101, MOR245-26
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 111960216-111961160 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 111960330 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 275 (D275E)
Ref Sequence ENSEMBL: ENSMUSP00000149103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099596] [ENSMUST00000213696]
AlphaFold Q8VG12
Predicted Effect possibly damaging
Transcript: ENSMUST00000099596
AA Change: D277E

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097191
Gene: ENSMUSG00000109801
AA Change: D277E

DomainStartEndE-ValueType
Pfam:7tm_4 32 307 5.9e-41 PFAM
Pfam:7tm_1 43 289 2.2e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213696
AA Change: D275E

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.0878 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b G A 15: 101,108,720 (GRCm39) V499M possibly damaging Het
Adam5 G A 8: 25,294,475 (GRCm39) Q375* probably null Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Aste1 G A 9: 105,274,189 (GRCm39) R143Q possibly damaging Het
Aste1 A T 9: 105,274,995 (GRCm39) T351S probably damaging Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Cdh22 T A 2: 164,988,646 (GRCm39) E236D probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col11a1 A G 3: 113,975,043 (GRCm39) D1234G probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dlec1 G A 9: 118,972,335 (GRCm39) probably null Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm4787 T A 12: 81,424,280 (GRCm39) D626V probably damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Krt36 T C 11: 99,993,635 (GRCm39) D401G possibly damaging Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Lrrc8b A G 5: 105,633,802 (GRCm39) N758S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Recql4 G T 15: 76,588,705 (GRCm39) H1035Q probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sh3d19 T G 3: 85,992,184 (GRCm39) W71G probably benign Het
Sidt1 T C 16: 44,065,529 (GRCm39) Y759C probably damaging Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Ssc5d A T 7: 4,939,328 (GRCm39) D588V probably damaging Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Szt2 A T 4: 118,244,015 (GRCm39) S1363R probably benign Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zfp473 G T 7: 44,382,323 (GRCm39) P670Q probably damaging Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Or4f14d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02072:Or4f14d APN 2 111,960,426 (GRCm39) missense probably damaging 1.00
R5120:Or4f14d UTSW 2 111,960,903 (GRCm39) missense probably damaging 1.00
R5849:Or4f14d UTSW 2 111,960,223 (GRCm39) missense probably benign 0.01
R6045:Or4f14d UTSW 2 111,960,881 (GRCm39) missense possibly damaging 0.69
R6156:Or4f14d UTSW 2 111,960,445 (GRCm39) missense probably damaging 1.00
R7621:Or4f14d UTSW 2 111,960,926 (GRCm39) missense probably benign 0.00
R7733:Or4f14d UTSW 2 111,960,386 (GRCm39) missense probably benign 0.01
R8803:Or4f14d UTSW 2 111,960,427 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCACCCTCCTAAGCAGAAG -3'
(R):5'- TGGGCTCCTTCTTCATATTGATAG -3'

Sequencing Primer
(F):5'- GAGTGTAGAAAGGCAATTTTTCCAC -3'
(R):5'- AAAGCCCTGTCCACACTT -3'
Posted On 2021-01-18