Mutagenetix > Incidental Mutation

Incidental Mutation 'R8480:Cdh22'

657460

Institutional Source

Beutler Lab

Gene Symbol

Cdh22

Ensembl Gene

ENSMUSG00000053166

Gene Name

cadherin 22

Synonyms

PB-cadherin

MMRRC Submission

067924-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.172) question?

Stock #

R8480 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

165111507-165234853 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 165146726 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 236 (E236D)

Ref Sequence

ENSEMBL: ENSMUSP00000120785 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065438] [ENSMUST00000138643]

AlphaFold

Q9WTP5

Predicted Effect

probably benign
Transcript: ENSMUST00000065438
AA Change: E236D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000066864
Gene: ENSMUSG00000053166
AA Change: E236D

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
CA	82	163	2.19e-16	SMART
CA	187	272	3.11e-30	SMART
CA	296	390	4.88e-14	SMART
CA	413	494	2.27e-23	SMART
CA	517	604	4.52e-9	SMART
transmembrane domain	622	644	N/A	INTRINSIC
Pfam:Cadherin_C	647	803	4.3e-46	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000138643
AA Change: E236D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000120785
Gene: ENSMUSG00000053166
AA Change: E236D

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
CA	82	163	2.19e-16	SMART
CA	187	272	3.11e-30	SMART
CA	296	390	4.88e-14	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. The gene product is composed of five cadherin repeat domains and a cytoplasmic tail similar to the highly conserved cytoplasmic region of classical cadherins. Expressed predominantly in the brain, this putative calcium-dependent cell adhesion protein may play an important role in morphogenesis and tissue formation in neural and non-neural cells during development and maintenance of the brain and neuroendocrine organs. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,187,458	P720Q	possibly damaging	Het
Acvr1b	G	A	15: 101,210,839	V499M	possibly damaging	Het
Adam5	G	A	8: 24,804,459	Q375*	probably null	Het
Adgrf1	G	A	17: 43,295,164	E60K	probably benign	Het
Alb	T	C	5: 90,462,771	V70A	probably damaging	Het
Aph1b	T	A	9: 66,788,427		probably benign	Het
Aste1	G	A	9: 105,396,990	R143Q	possibly damaging	Het
Aste1	A	T	9: 105,397,796	T351S	probably damaging	Het
Bace2	T	A	16: 97,413,470	L286Q	probably damaging	Het
Bach1	G	A	16: 87,719,275	G235R	probably damaging	Het
Brwd1	A	T	16: 96,047,430	H516Q	probably damaging	Het
Cc2d2a	C	A	5: 43,685,144		probably null	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Celsr2	T	A	3: 108,398,902	T2029S	probably benign	Het
Col11a1	A	G	3: 114,181,394	D1234G	probably benign	Het
Cpt2	A	G	4: 107,907,760	I269T	probably damaging	Het
Dcaf7	T	A	11: 106,054,793	S323T	probably benign	Het
Ddias	G	T	7: 92,859,400	Q436K	probably benign	Het
Dlec1	G	A	9: 119,143,267		probably null	Het
Dock5	T	A	14: 67,836,410	I294F	probably benign	Het
Fat2	A	T	11: 55,282,968	D2306E	possibly damaging	Het
Gm4787	T	A	12: 81,377,506	D626V	probably damaging	Het
Gm6563	A	G	19: 23,675,926	T27A	probably benign	Het
Hadhb	T	C	5: 30,168,570		probably null	Het
Hsph1	A	T	5: 149,627,564	W406R	probably null	Het
Ighv1-66	C	T	12: 115,593,382	G27R	possibly damaging	Het
Impad1	C	T	4: 4,769,376	M246I	probably benign	Het
Krt26	T	C	11: 99,337,600	E102G	probably damaging	Het
Krt34	T	A	11: 100,040,145		probably null	Het
Krt36	T	C	11: 100,102,809	D401G	possibly damaging	Het
Loxhd1	G	A	18: 77,431,131	G326S	probably damaging	Het
Lrrc8b	A	G	5: 105,485,936	N758S	probably damaging	Het
Mkl2	A	T	16: 13,384,192		probably null	Het
Muc4	C	T	16: 32,752,993	T957I	probably benign	Het
Naip5	T	C	13: 100,222,235	Y831C	probably damaging	Het
Nfatc1	A	T	18: 80,635,644	V829E	probably benign	Het
Nmnat1	G	A	4: 149,473,370	L72F	possibly damaging	Het
Olfr1316	A	T	2: 112,129,985	D275E	possibly damaging	Het
Pcdh7	T	A	5: 58,129,065	V1161E	probably damaging	Het
Raver1	A	G	9: 21,090,280	Y86H	probably benign	Het
Recql4	G	T	15: 76,704,505	H1035Q	probably benign	Het
Sgsm1	A	T	5: 113,263,418	M814K	probably benign	Het
Sh3d19	T	G	3: 86,084,877	W71G	probably benign	Het
Sidt1	T	C	16: 44,245,166	Y759C	probably damaging	Het
Spg11	G	T	2: 122,113,079	D197E	probably damaging	Het
Sppl2b	TGTCACAGGT	TGT	10: 80,866,069		probably null	Het
Ssc5d	A	T	7: 4,936,329	D588V	probably damaging	Het
Supt20	C	A	3: 54,707,116	T181K	probably damaging	Het
Szt2	A	T	4: 118,386,818	S1363R	probably benign	Het
Tbcel	G	A	9: 42,463,873		probably null	Het
Ube2e3	T	C	2: 78,918,814	L169P	probably damaging	Het
Wrn	A	G	8: 33,288,768	F595S	probably benign	Het
Zfp473	G	T	7: 44,732,899	P670Q	probably damaging	Het
Zw10	C	T	9: 49,074,999	A660V	probably benign	Het

Other mutations in Cdh22

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Cdh22	APN	2	165112601	missense	possibly damaging	0.54
IGL01868:Cdh22	APN	2	165157358	missense	probably damaging	0.99
IGL01932:Cdh22	APN	2	165170808	missense	probably benign	0.05
IGL02268:Cdh22	APN	2	165123719	splice site	probably benign
IGL02455:Cdh22	APN	2	165142255	missense	possibly damaging	0.46
IGL03231:Cdh22	APN	2	165116206	missense	probably benign	0.16
IGL03264:Cdh22	APN	2	165116173	missense	probably benign	0.21
IGL03014:Cdh22	UTSW	2	165112411	nonsense	probably null
R0712:Cdh22	UTSW	2	165170656	missense	probably damaging	1.00
R0865:Cdh22	UTSW	2	165181056	missense	probably damaging	0.98
R1192:Cdh22	UTSW	2	165135283	missense	probably damaging	1.00
R1700:Cdh22	UTSW	2	165170796	missense	probably damaging	1.00
R1844:Cdh22	UTSW	2	165143694	missense	probably damaging	1.00
R2005:Cdh22	UTSW	2	165180923	missense	probably damaging	1.00
R2137:Cdh22	UTSW	2	165116394	splice site	probably benign
R2270:Cdh22	UTSW	2	165143847	splice site	probably null
R2271:Cdh22	UTSW	2	165143847	splice site	probably null
R2272:Cdh22	UTSW	2	165143847	splice site	probably null
R4021:Cdh22	UTSW	2	165143673	missense	possibly damaging	0.81
R4022:Cdh22	UTSW	2	165157253	missense	probably benign	0.14
R4613:Cdh22	UTSW	2	165143656	missense	probably benign
R4625:Cdh22	UTSW	2	165112606	missense	probably damaging	1.00
R5038:Cdh22	UTSW	2	165142277	missense	probably benign	0.16
R5057:Cdh22	UTSW	2	165116143	missense	probably damaging	0.98
R5649:Cdh22	UTSW	2	165116280	missense	probably damaging	1.00
R6175:Cdh22	UTSW	2	165146630	missense	probably damaging	0.98
R6297:Cdh22	UTSW	2	165143644	missense	possibly damaging	0.86
R6445:Cdh22	UTSW	2	165170692	missense	probably damaging	0.97
R7294:Cdh22	UTSW	2	165142093	missense	possibly damaging	0.94
R7310:Cdh22	UTSW	2	165112294	nonsense	probably null
R7595:Cdh22	UTSW	2	165112463	missense	probably benign	0.00
R7601:Cdh22	UTSW	2	165112546	missense	probably damaging	1.00
R8047:Cdh22	UTSW	2	165170767	missense	probably damaging	1.00
R8308:Cdh22	UTSW	2	165112178	missense	probably damaging	0.99
R8526:Cdh22	UTSW	2	165112258	missense	probably damaging	1.00
R8771:Cdh22	UTSW	2	165146769	missense	possibly damaging	0.94
R8927:Cdh22	UTSW	2	165123584	missense	possibly damaging	0.58
R8928:Cdh22	UTSW	2	165123584	missense	possibly damaging	0.58
R9158:Cdh22	UTSW	2	165170707	missense	probably damaging	1.00
R9433:Cdh22	UTSW	2	165112409	missense	probably benign	0.32
R9498:Cdh22	UTSW	2	165112570	missense	probably damaging	1.00
R9638:Cdh22	UTSW	2	165146767	missense	probably damaging	0.97
R9657:Cdh22	UTSW	2	165123795	missense	probably benign	0.01
Z1088:Cdh22	UTSW	2	165112430	missense	probably benign	0.01
Z1176:Cdh22	UTSW	2	165116184	missense	probably damaging	1.00
Z1177:Cdh22	UTSW	2	165146680	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGAACACCCGTATGGCAG -3'
(R):5'- CACATGTGACTTGTGCACC -3'

Sequencing Primer
(F):5'- TATGGCAGTCTCCCGTCAG -3'
(R):5'- ATGTGACTTGTGCACCCATGTC -3'

Posted On

2021-01-18