Incidental Mutation 'R8480:Cdh22'
ID 657460
Institutional Source Beutler Lab
Gene Symbol Cdh22
Ensembl Gene ENSMUSG00000053166
Gene Name cadherin 22
Synonyms PB-cadherin
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.137) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 164953427-165076773 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 164988646 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 236 (E236D)
Ref Sequence ENSEMBL: ENSMUSP00000120785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065438] [ENSMUST00000138643]
AlphaFold Q9WTP5
Predicted Effect probably benign
Transcript: ENSMUST00000065438
AA Change: E236D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066864
Gene: ENSMUSG00000053166
AA Change: E236D

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
CA 413 494 2.27e-23 SMART
CA 517 604 4.52e-9 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 803 4.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138643
AA Change: E236D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120785
Gene: ENSMUSG00000053166
AA Change: E236D

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. The gene product is composed of five cadherin repeat domains and a cytoplasmic tail similar to the highly conserved cytoplasmic region of classical cadherins. Expressed predominantly in the brain, this putative calcium-dependent cell adhesion protein may play an important role in morphogenesis and tissue formation in neural and non-neural cells during development and maintenance of the brain and neuroendocrine organs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b G A 15: 101,108,720 (GRCm39) V499M possibly damaging Het
Adam5 G A 8: 25,294,475 (GRCm39) Q375* probably null Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Aste1 G A 9: 105,274,189 (GRCm39) R143Q possibly damaging Het
Aste1 A T 9: 105,274,995 (GRCm39) T351S probably damaging Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col11a1 A G 3: 113,975,043 (GRCm39) D1234G probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dlec1 G A 9: 118,972,335 (GRCm39) probably null Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm4787 T A 12: 81,424,280 (GRCm39) D626V probably damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Krt36 T C 11: 99,993,635 (GRCm39) D401G possibly damaging Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Lrrc8b A G 5: 105,633,802 (GRCm39) N758S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Or4f14d A T 2: 111,960,330 (GRCm39) D275E possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Recql4 G T 15: 76,588,705 (GRCm39) H1035Q probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sh3d19 T G 3: 85,992,184 (GRCm39) W71G probably benign Het
Sidt1 T C 16: 44,065,529 (GRCm39) Y759C probably damaging Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Ssc5d A T 7: 4,939,328 (GRCm39) D588V probably damaging Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Szt2 A T 4: 118,244,015 (GRCm39) S1363R probably benign Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zfp473 G T 7: 44,382,323 (GRCm39) P670Q probably damaging Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Cdh22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cdh22 APN 2 164,954,521 (GRCm39) missense possibly damaging 0.54
IGL01868:Cdh22 APN 2 164,999,278 (GRCm39) missense probably damaging 0.99
IGL01932:Cdh22 APN 2 165,012,728 (GRCm39) missense probably benign 0.05
IGL02268:Cdh22 APN 2 164,965,639 (GRCm39) splice site probably benign
IGL02455:Cdh22 APN 2 164,984,175 (GRCm39) missense possibly damaging 0.46
IGL03231:Cdh22 APN 2 164,958,126 (GRCm39) missense probably benign 0.16
IGL03264:Cdh22 APN 2 164,958,093 (GRCm39) missense probably benign 0.21
IGL03014:Cdh22 UTSW 2 164,954,331 (GRCm39) nonsense probably null
R0712:Cdh22 UTSW 2 165,012,576 (GRCm39) missense probably damaging 1.00
R0865:Cdh22 UTSW 2 165,022,976 (GRCm39) missense probably damaging 0.98
R1192:Cdh22 UTSW 2 164,977,203 (GRCm39) missense probably damaging 1.00
R1700:Cdh22 UTSW 2 165,012,716 (GRCm39) missense probably damaging 1.00
R1844:Cdh22 UTSW 2 164,985,614 (GRCm39) missense probably damaging 1.00
R2005:Cdh22 UTSW 2 165,022,843 (GRCm39) missense probably damaging 1.00
R2137:Cdh22 UTSW 2 164,958,314 (GRCm39) splice site probably benign
R2270:Cdh22 UTSW 2 164,985,767 (GRCm39) splice site probably null
R2271:Cdh22 UTSW 2 164,985,767 (GRCm39) splice site probably null
R2272:Cdh22 UTSW 2 164,985,767 (GRCm39) splice site probably null
R4021:Cdh22 UTSW 2 164,985,593 (GRCm39) missense possibly damaging 0.81
R4022:Cdh22 UTSW 2 164,999,173 (GRCm39) missense probably benign 0.14
R4613:Cdh22 UTSW 2 164,985,576 (GRCm39) missense probably benign
R4625:Cdh22 UTSW 2 164,954,526 (GRCm39) missense probably damaging 1.00
R5038:Cdh22 UTSW 2 164,984,197 (GRCm39) missense probably benign 0.16
R5057:Cdh22 UTSW 2 164,958,063 (GRCm39) missense probably damaging 0.98
R5649:Cdh22 UTSW 2 164,958,200 (GRCm39) missense probably damaging 1.00
R6175:Cdh22 UTSW 2 164,988,550 (GRCm39) missense probably damaging 0.98
R6297:Cdh22 UTSW 2 164,985,564 (GRCm39) missense possibly damaging 0.86
R6445:Cdh22 UTSW 2 165,012,612 (GRCm39) missense probably damaging 0.97
R7294:Cdh22 UTSW 2 164,984,013 (GRCm39) missense possibly damaging 0.94
R7310:Cdh22 UTSW 2 164,954,214 (GRCm39) nonsense probably null
R7595:Cdh22 UTSW 2 164,954,383 (GRCm39) missense probably benign 0.00
R7601:Cdh22 UTSW 2 164,954,466 (GRCm39) missense probably damaging 1.00
R8047:Cdh22 UTSW 2 165,012,687 (GRCm39) missense probably damaging 1.00
R8308:Cdh22 UTSW 2 164,954,098 (GRCm39) missense probably damaging 0.99
R8526:Cdh22 UTSW 2 164,954,178 (GRCm39) missense probably damaging 1.00
R8771:Cdh22 UTSW 2 164,988,689 (GRCm39) missense possibly damaging 0.94
R8927:Cdh22 UTSW 2 164,965,504 (GRCm39) missense possibly damaging 0.58
R8928:Cdh22 UTSW 2 164,965,504 (GRCm39) missense possibly damaging 0.58
R9158:Cdh22 UTSW 2 165,012,627 (GRCm39) missense probably damaging 1.00
R9433:Cdh22 UTSW 2 164,954,329 (GRCm39) missense probably benign 0.32
R9498:Cdh22 UTSW 2 164,954,490 (GRCm39) missense probably damaging 1.00
R9638:Cdh22 UTSW 2 164,988,687 (GRCm39) missense probably damaging 0.97
R9657:Cdh22 UTSW 2 164,965,715 (GRCm39) missense probably benign 0.01
Z1088:Cdh22 UTSW 2 164,954,350 (GRCm39) missense probably benign 0.01
Z1176:Cdh22 UTSW 2 164,958,104 (GRCm39) missense probably damaging 1.00
Z1177:Cdh22 UTSW 2 164,988,600 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGAACACCCGTATGGCAG -3'
(R):5'- CACATGTGACTTGTGCACC -3'

Sequencing Primer
(F):5'- TATGGCAGTCTCCCGTCAG -3'
(R):5'- ATGTGACTTGTGCACCCATGTC -3'
Posted On 2021-01-18