Incidental Mutation 'R8480:Sh3d19'
ID 657462
Institutional Source Beutler Lab
Gene Symbol Sh3d19
Ensembl Gene ENSMUSG00000028082
Gene Name SH3 domain protein D19
Synonyms Kryn
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 85971109-86130526 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 86084877 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Glycine at position 71 (W71G)
Ref Sequence ENSEMBL: ENSMUSP00000138320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107664] [ENSMUST00000182666]
AlphaFold Q91X43
Predicted Effect probably benign
Transcript: ENSMUST00000107664
AA Change: W71G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103291
Gene: ENSMUSG00000028082
AA Change: W71G

DomainStartEndE-ValueType
low complexity region 336 361 N/A INTRINSIC
SH3 417 472 1.33e-3 SMART
SH3 497 552 1.88e-21 SMART
SH3 573 628 3.99e-16 SMART
SH3 663 718 2.8e-20 SMART
SH3 732 787 7.62e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182666
AA Change: W71G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138320
Gene: ENSMUSG00000028082
AA Change: W71G

DomainStartEndE-ValueType
low complexity region 336 361 N/A INTRINSIC
SH3 417 472 1.33e-3 SMART
SH3 497 552 1.88e-21 SMART
SH3 573 628 3.99e-16 SMART
SH3 663 718 2.8e-20 SMART
SH3 732 787 7.62e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multiple SH3 domain-containing protein, which interacts with other proteins, such as EBP and members of ADAM family, via the SH3 domains. This protein may be involved in suppression of Ras-induced cellular transformation and Ras-mediated activation of ELK1 by EBP, and regulation of ADAM proteins in the signaling of EGFR-ligand shedding. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,187,458 P720Q possibly damaging Het
Acvr1b G A 15: 101,210,839 V499M possibly damaging Het
Adam5 G A 8: 24,804,459 Q375* probably null Het
Adgrf1 G A 17: 43,295,164 E60K probably benign Het
Alb T C 5: 90,462,771 V70A probably damaging Het
Aph1b T A 9: 66,788,427 probably benign Het
Aste1 G A 9: 105,396,990 R143Q possibly damaging Het
Aste1 A T 9: 105,397,796 T351S probably damaging Het
Bace2 T A 16: 97,413,470 L286Q probably damaging Het
Bach1 G A 16: 87,719,275 G235R probably damaging Het
Brwd1 A T 16: 96,047,430 H516Q probably damaging Het
Cc2d2a C A 5: 43,685,144 probably null Het
Cdh22 T A 2: 165,146,726 E236D probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Col11a1 A G 3: 114,181,394 D1234G probably benign Het
Cpt2 A G 4: 107,907,760 I269T probably damaging Het
Dcaf7 T A 11: 106,054,793 S323T probably benign Het
Ddias G T 7: 92,859,400 Q436K probably benign Het
Dlec1 G A 9: 119,143,267 probably null Het
Dock5 T A 14: 67,836,410 I294F probably benign Het
Fat2 A T 11: 55,282,968 D2306E possibly damaging Het
Gm4787 T A 12: 81,377,506 D626V probably damaging Het
Gm6563 A G 19: 23,675,926 T27A probably benign Het
Hadhb T C 5: 30,168,570 probably null Het
Hsph1 A T 5: 149,627,564 W406R probably null Het
Ighv1-66 C T 12: 115,593,382 G27R possibly damaging Het
Impad1 C T 4: 4,769,376 M246I probably benign Het
Krt26 T C 11: 99,337,600 E102G probably damaging Het
Krt34 T A 11: 100,040,145 probably null Het
Krt36 T C 11: 100,102,809 D401G possibly damaging Het
Loxhd1 G A 18: 77,431,131 G326S probably damaging Het
Lrrc8b A G 5: 105,485,936 N758S probably damaging Het
Mkl2 A T 16: 13,384,192 probably null Het
Muc4 C T 16: 32,752,993 T957I probably benign Het
Naip5 T C 13: 100,222,235 Y831C probably damaging Het
Nfatc1 A T 18: 80,635,644 V829E probably benign Het
Nmnat1 G A 4: 149,473,370 L72F possibly damaging Het
Olfr1316 A T 2: 112,129,985 D275E possibly damaging Het
Pcdh7 T A 5: 58,129,065 V1161E probably damaging Het
Raver1 A G 9: 21,090,280 Y86H probably benign Het
Recql4 G T 15: 76,704,505 H1035Q probably benign Het
Sgsm1 A T 5: 113,263,418 M814K probably benign Het
Sidt1 T C 16: 44,245,166 Y759C probably damaging Het
Spg11 G T 2: 122,113,079 D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Ssc5d A T 7: 4,936,329 D588V probably damaging Het
Supt20 C A 3: 54,707,116 T181K probably damaging Het
Szt2 A T 4: 118,386,818 S1363R probably benign Het
Tbcel G A 9: 42,463,873 probably null Het
Ube2e3 T C 2: 78,918,814 L169P probably damaging Het
Wrn A G 8: 33,288,768 F595S probably benign Het
Zfp473 G T 7: 44,732,899 P670Q probably damaging Het
Zw10 C T 9: 49,074,999 A660V probably benign Het
Other mutations in Sh3d19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Sh3d19 APN 3 86098185 missense probably benign 0.01
IGL01483:Sh3d19 APN 3 86114796 missense probably benign 0.09
IGL02272:Sh3d19 APN 3 86121167 missense probably benign 0.02
IGL02308:Sh3d19 APN 3 86093710 missense probably damaging 0.98
IGL02431:Sh3d19 APN 3 86106998 missense probably damaging 1.00
R0277:Sh3d19 UTSW 3 86126671 missense probably benign 0.00
R0323:Sh3d19 UTSW 3 86126671 missense probably benign 0.00
R0624:Sh3d19 UTSW 3 86114906 missense possibly damaging 0.96
R0639:Sh3d19 UTSW 3 86106973 missense probably benign 0.00
R0673:Sh3d19 UTSW 3 86106973 missense probably benign 0.00
R1148:Sh3d19 UTSW 3 86107327 missense possibly damaging 0.82
R1148:Sh3d19 UTSW 3 86107327 missense possibly damaging 0.82
R1569:Sh3d19 UTSW 3 86126644 missense possibly damaging 0.83
R1738:Sh3d19 UTSW 3 86120606 missense probably damaging 1.00
R3911:Sh3d19 UTSW 3 86107227 missense possibly damaging 0.62
R3913:Sh3d19 UTSW 3 86084776 missense probably damaging 0.97
R4246:Sh3d19 UTSW 3 86126688 missense probably benign 0.06
R4327:Sh3d19 UTSW 3 86123713 missense probably benign
R4663:Sh3d19 UTSW 3 86123263 missense probably benign 0.06
R4730:Sh3d19 UTSW 3 86116864 missense possibly damaging 0.89
R4812:Sh3d19 UTSW 3 86123767 missense probably damaging 1.00
R4841:Sh3d19 UTSW 3 86123742 missense probably damaging 1.00
R4842:Sh3d19 UTSW 3 86123742 missense probably damaging 1.00
R5814:Sh3d19 UTSW 3 86126604 missense probably benign 0.00
R6279:Sh3d19 UTSW 3 86104102 missense possibly damaging 0.77
R6504:Sh3d19 UTSW 3 86085336 missense probably benign
R6806:Sh3d19 UTSW 3 86104333 missense probably damaging 0.99
R6916:Sh3d19 UTSW 3 86084911 missense probably benign 0.03
R7012:Sh3d19 UTSW 3 86085013 missense probably benign 0.01
R7147:Sh3d19 UTSW 3 86104277 missense possibly damaging 0.71
R7367:Sh3d19 UTSW 3 86104228 missense probably benign 0.21
R7590:Sh3d19 UTSW 3 86114906 missense possibly damaging 0.96
R7739:Sh3d19 UTSW 3 86123731 missense probably benign
R7971:Sh3d19 UTSW 3 86114796 missense probably benign 0.09
R8321:Sh3d19 UTSW 3 86093764 missense probably damaging 1.00
R8354:Sh3d19 UTSW 3 86107022 missense probably benign 0.00
R8415:Sh3d19 UTSW 3 86085056 missense probably benign 0.01
R8454:Sh3d19 UTSW 3 86107022 missense probably benign 0.00
R8703:Sh3d19 UTSW 3 86107261 missense probably damaging 0.99
R8807:Sh3d19 UTSW 3 86085352 missense probably benign 0.00
R9032:Sh3d19 UTSW 3 86126685 missense probably damaging 1.00
R9085:Sh3d19 UTSW 3 86126685 missense probably damaging 1.00
R9171:Sh3d19 UTSW 3 86083611 start gained probably benign
R9219:Sh3d19 UTSW 3 86123200 missense possibly damaging 0.94
R9610:Sh3d19 UTSW 3 86107222 missense possibly damaging 0.94
R9777:Sh3d19 UTSW 3 86121176 missense probably benign 0.00
X0027:Sh3d19 UTSW 3 86120703 missense probably damaging 1.00
Z1177:Sh3d19 UTSW 3 86107024 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCAGGCAATGATGAACATTATG -3'
(R):5'- TCGGTGGAATCGAAGGGTAC -3'

Sequencing Primer
(F):5'- CAGGCAATGATGAACATTATGAACAC -3'
(R):5'- TTTTTCGGCAGCAAAGGC -3'
Posted On 2021-01-18