Incidental Mutation 'R8480:Sh3d19'
ID 657462
Institutional Source Beutler Lab
Gene Symbol Sh3d19
Ensembl Gene ENSMUSG00000028082
Gene Name SH3 domain protein D19
Synonyms Kryn
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 85878416-86037833 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 85992184 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Glycine at position 71 (W71G)
Ref Sequence ENSEMBL: ENSMUSP00000138320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107664] [ENSMUST00000182666]
AlphaFold Q91X43
Predicted Effect probably benign
Transcript: ENSMUST00000107664
AA Change: W71G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103291
Gene: ENSMUSG00000028082
AA Change: W71G

DomainStartEndE-ValueType
low complexity region 336 361 N/A INTRINSIC
SH3 417 472 1.33e-3 SMART
SH3 497 552 1.88e-21 SMART
SH3 573 628 3.99e-16 SMART
SH3 663 718 2.8e-20 SMART
SH3 732 787 7.62e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182666
AA Change: W71G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138320
Gene: ENSMUSG00000028082
AA Change: W71G

DomainStartEndE-ValueType
low complexity region 336 361 N/A INTRINSIC
SH3 417 472 1.33e-3 SMART
SH3 497 552 1.88e-21 SMART
SH3 573 628 3.99e-16 SMART
SH3 663 718 2.8e-20 SMART
SH3 732 787 7.62e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multiple SH3 domain-containing protein, which interacts with other proteins, such as EBP and members of ADAM family, via the SH3 domains. This protein may be involved in suppression of Ras-induced cellular transformation and Ras-mediated activation of ELK1 by EBP, and regulation of ADAM proteins in the signaling of EGFR-ligand shedding. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b G A 15: 101,108,720 (GRCm39) V499M possibly damaging Het
Adam5 G A 8: 25,294,475 (GRCm39) Q375* probably null Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Aste1 G A 9: 105,274,189 (GRCm39) R143Q possibly damaging Het
Aste1 A T 9: 105,274,995 (GRCm39) T351S probably damaging Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Cdh22 T A 2: 164,988,646 (GRCm39) E236D probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col11a1 A G 3: 113,975,043 (GRCm39) D1234G probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dlec1 G A 9: 118,972,335 (GRCm39) probably null Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm4787 T A 12: 81,424,280 (GRCm39) D626V probably damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Krt36 T C 11: 99,993,635 (GRCm39) D401G possibly damaging Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Lrrc8b A G 5: 105,633,802 (GRCm39) N758S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Or4f14d A T 2: 111,960,330 (GRCm39) D275E possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Recql4 G T 15: 76,588,705 (GRCm39) H1035Q probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sidt1 T C 16: 44,065,529 (GRCm39) Y759C probably damaging Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Ssc5d A T 7: 4,939,328 (GRCm39) D588V probably damaging Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Szt2 A T 4: 118,244,015 (GRCm39) S1363R probably benign Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zfp473 G T 7: 44,382,323 (GRCm39) P670Q probably damaging Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Sh3d19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Sh3d19 APN 3 86,005,492 (GRCm39) missense probably benign 0.01
IGL01483:Sh3d19 APN 3 86,022,103 (GRCm39) missense probably benign 0.09
IGL02272:Sh3d19 APN 3 86,028,474 (GRCm39) missense probably benign 0.02
IGL02308:Sh3d19 APN 3 86,001,017 (GRCm39) missense probably damaging 0.98
IGL02431:Sh3d19 APN 3 86,014,305 (GRCm39) missense probably damaging 1.00
R0277:Sh3d19 UTSW 3 86,033,978 (GRCm39) missense probably benign 0.00
R0323:Sh3d19 UTSW 3 86,033,978 (GRCm39) missense probably benign 0.00
R0624:Sh3d19 UTSW 3 86,022,213 (GRCm39) missense possibly damaging 0.96
R0639:Sh3d19 UTSW 3 86,014,280 (GRCm39) missense probably benign 0.00
R0673:Sh3d19 UTSW 3 86,014,280 (GRCm39) missense probably benign 0.00
R1148:Sh3d19 UTSW 3 86,014,634 (GRCm39) missense possibly damaging 0.82
R1148:Sh3d19 UTSW 3 86,014,634 (GRCm39) missense possibly damaging 0.82
R1569:Sh3d19 UTSW 3 86,033,951 (GRCm39) missense possibly damaging 0.83
R1738:Sh3d19 UTSW 3 86,027,913 (GRCm39) missense probably damaging 1.00
R3911:Sh3d19 UTSW 3 86,014,534 (GRCm39) missense possibly damaging 0.62
R3913:Sh3d19 UTSW 3 85,992,083 (GRCm39) missense probably damaging 0.97
R4246:Sh3d19 UTSW 3 86,033,995 (GRCm39) missense probably benign 0.06
R4327:Sh3d19 UTSW 3 86,031,020 (GRCm39) missense probably benign
R4663:Sh3d19 UTSW 3 86,030,570 (GRCm39) missense probably benign 0.06
R4730:Sh3d19 UTSW 3 86,024,171 (GRCm39) missense possibly damaging 0.89
R4812:Sh3d19 UTSW 3 86,031,074 (GRCm39) missense probably damaging 1.00
R4841:Sh3d19 UTSW 3 86,031,049 (GRCm39) missense probably damaging 1.00
R4842:Sh3d19 UTSW 3 86,031,049 (GRCm39) missense probably damaging 1.00
R5814:Sh3d19 UTSW 3 86,033,911 (GRCm39) missense probably benign 0.00
R6279:Sh3d19 UTSW 3 86,011,409 (GRCm39) missense possibly damaging 0.77
R6504:Sh3d19 UTSW 3 85,992,643 (GRCm39) missense probably benign
R6806:Sh3d19 UTSW 3 86,011,640 (GRCm39) missense probably damaging 0.99
R6916:Sh3d19 UTSW 3 85,992,218 (GRCm39) missense probably benign 0.03
R7012:Sh3d19 UTSW 3 85,992,320 (GRCm39) missense probably benign 0.01
R7147:Sh3d19 UTSW 3 86,011,584 (GRCm39) missense possibly damaging 0.71
R7367:Sh3d19 UTSW 3 86,011,535 (GRCm39) missense probably benign 0.21
R7590:Sh3d19 UTSW 3 86,022,213 (GRCm39) missense possibly damaging 0.96
R7739:Sh3d19 UTSW 3 86,031,038 (GRCm39) missense probably benign
R7971:Sh3d19 UTSW 3 86,022,103 (GRCm39) missense probably benign 0.09
R8321:Sh3d19 UTSW 3 86,001,071 (GRCm39) missense probably damaging 1.00
R8354:Sh3d19 UTSW 3 86,014,329 (GRCm39) missense probably benign 0.00
R8415:Sh3d19 UTSW 3 85,992,363 (GRCm39) missense probably benign 0.01
R8454:Sh3d19 UTSW 3 86,014,329 (GRCm39) missense probably benign 0.00
R8703:Sh3d19 UTSW 3 86,014,568 (GRCm39) missense probably damaging 0.99
R8807:Sh3d19 UTSW 3 85,992,659 (GRCm39) missense probably benign 0.00
R9032:Sh3d19 UTSW 3 86,033,992 (GRCm39) missense probably damaging 1.00
R9085:Sh3d19 UTSW 3 86,033,992 (GRCm39) missense probably damaging 1.00
R9171:Sh3d19 UTSW 3 85,990,918 (GRCm39) start gained probably benign
R9219:Sh3d19 UTSW 3 86,030,507 (GRCm39) missense possibly damaging 0.94
R9610:Sh3d19 UTSW 3 86,014,529 (GRCm39) missense possibly damaging 0.94
R9777:Sh3d19 UTSW 3 86,028,483 (GRCm39) missense probably benign 0.00
X0027:Sh3d19 UTSW 3 86,028,010 (GRCm39) missense probably damaging 1.00
Z1177:Sh3d19 UTSW 3 86,014,331 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCAGGCAATGATGAACATTATG -3'
(R):5'- TCGGTGGAATCGAAGGGTAC -3'

Sequencing Primer
(F):5'- CAGGCAATGATGAACATTATGAACAC -3'
(R):5'- TTTTTCGGCAGCAAAGGC -3'
Posted On 2021-01-18