Incidental Mutation 'R8480:Col11a1'
ID 657464
Institutional Source Beutler Lab
Gene Symbol Col11a1
Ensembl Gene ENSMUSG00000027966
Gene Name collagen, type XI, alpha 1
Synonyms C530001D20Rik
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.939) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 113824189-114014367 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113975043 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1234 (D1234G)
Ref Sequence ENSEMBL: ENSMUSP00000089793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092155] [ENSMUST00000184978]
AlphaFold Q61245
Predicted Effect probably benign
Transcript: ENSMUST00000092155
AA Change: D1234G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000089793
Gene: ENSMUSG00000027966
AA Change: D1234G

DomainStartEndE-ValueType
TSPN 37 228 1.83e-62 SMART
LamG 96 227 5.87e-11 SMART
low complexity region 256 276 N/A INTRINSIC
internal_repeat_4 357 431 3.12e-6 PROSPERO
Pfam:Collagen 433 491 2.6e-9 PFAM
Pfam:Collagen 525 586 5.9e-9 PFAM
low complexity region 611 632 N/A INTRINSIC
low complexity region 638 677 N/A INTRINSIC
Pfam:Collagen 721 805 3.6e-8 PFAM
internal_repeat_3 814 854 3.55e-9 PROSPERO
internal_repeat_1 818 869 2.01e-16 PROSPERO
low complexity region 872 944 N/A INTRINSIC
low complexity region 952 1001 N/A INTRINSIC
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1066 1100 N/A INTRINSIC
low complexity region 1103 1121 N/A INTRINSIC
internal_repeat_2 1124 1188 2.4e-12 PROSPERO
low complexity region 1189 1205 N/A INTRINSIC
low complexity region 1211 1232 N/A INTRINSIC
low complexity region 1235 1250 N/A INTRINSIC
low complexity region 1252 1368 N/A INTRINSIC
low complexity region 1373 1392 N/A INTRINSIC
low complexity region 1417 1448 N/A INTRINSIC
low complexity region 1453 1463 N/A INTRINSIC
Pfam:Collagen 1481 1543 8.3e-9 PFAM
COLFI 1574 1803 7.28e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000184978
AA Change: D94G
SMART Domains Protein: ENSMUSP00000138879
Gene: ENSMUSG00000027966
AA Change: D94G

DomainStartEndE-ValueType
Pfam:Collagen 1 57 6.3e-10 PFAM
Pfam:Collagen 49 110 3.2e-10 PFAM
Pfam:Collagen 95 165 6.2e-8 PFAM
Pfam:Collagen 242 318 2.2e-9 PFAM
Pfam:Collagen 289 362 1.6e-7 PFAM
Pfam:Collagen 341 403 2e-9 PFAM
COLFI 434 536 8.88e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XI collagen, one of the low abundance fibrillar collagens that is essential for normal embryonic skeletal development and the cohesive properties of cartilage. The encoded protein, in association with the alpha-1 subunit of type II collagen, forms a heterotrimeric type XI procollagen that undergoes proteolytic processing. Mice lacking the encoded protein develop severe chondrodysplasia and die at birth. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality by asphyxia. Mutants animals display weak tracheal cartilage, short snout, short mandible, cleft palate, short limbs, and externally rotated distal portion of the hindlimbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b G A 15: 101,108,720 (GRCm39) V499M possibly damaging Het
Adam5 G A 8: 25,294,475 (GRCm39) Q375* probably null Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Aste1 G A 9: 105,274,189 (GRCm39) R143Q possibly damaging Het
Aste1 A T 9: 105,274,995 (GRCm39) T351S probably damaging Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Cdh22 T A 2: 164,988,646 (GRCm39) E236D probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dlec1 G A 9: 118,972,335 (GRCm39) probably null Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm4787 T A 12: 81,424,280 (GRCm39) D626V probably damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Krt36 T C 11: 99,993,635 (GRCm39) D401G possibly damaging Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Lrrc8b A G 5: 105,633,802 (GRCm39) N758S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Or4f14d A T 2: 111,960,330 (GRCm39) D275E possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Recql4 G T 15: 76,588,705 (GRCm39) H1035Q probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sh3d19 T G 3: 85,992,184 (GRCm39) W71G probably benign Het
Sidt1 T C 16: 44,065,529 (GRCm39) Y759C probably damaging Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Ssc5d A T 7: 4,939,328 (GRCm39) D588V probably damaging Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Szt2 A T 4: 118,244,015 (GRCm39) S1363R probably benign Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zfp473 G T 7: 44,382,323 (GRCm39) P670Q probably damaging Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Col11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Col11a1 APN 3 113,860,182 (GRCm39) missense unknown
IGL00578:Col11a1 APN 3 113,987,755 (GRCm39) missense possibly damaging 0.95
IGL00742:Col11a1 APN 3 113,917,964 (GRCm39) missense unknown
IGL01014:Col11a1 APN 3 113,917,458 (GRCm39) splice site probably benign
IGL01099:Col11a1 APN 3 113,905,690 (GRCm39) nonsense probably null
IGL01129:Col11a1 APN 3 113,979,522 (GRCm39) splice site probably benign
IGL01474:Col11a1 APN 3 114,010,783 (GRCm39) utr 3 prime probably benign
IGL01884:Col11a1 APN 3 113,860,191 (GRCm39) missense unknown
IGL02104:Col11a1 APN 3 113,975,046 (GRCm39) critical splice donor site probably null
IGL02715:Col11a1 APN 3 113,923,058 (GRCm39) missense probably benign 0.06
IGL02978:Col11a1 APN 3 113,855,211 (GRCm39) missense unknown
IGL03203:Col11a1 APN 3 114,005,733 (GRCm39) missense possibly damaging 0.91
IGL03240:Col11a1 APN 3 114,010,859 (GRCm39) splice site probably null
IGL03357:Col11a1 APN 3 113,987,740 (GRCm39) missense probably damaging 1.00
IGL03390:Col11a1 APN 3 113,883,902 (GRCm39) missense unknown
gluon UTSW 3 114,010,819 (GRCm39) utr 3 prime probably benign
uncovered UTSW 3 113,906,116 (GRCm39) unclassified probably benign
weakforce UTSW 3 113,907,249 (GRCm39) missense unknown
R0110:Col11a1 UTSW 3 113,899,105 (GRCm39) splice site probably benign
R0144:Col11a1 UTSW 3 113,907,243 (GRCm39) missense unknown
R0432:Col11a1 UTSW 3 113,999,550 (GRCm39) splice site probably benign
R0468:Col11a1 UTSW 3 114,010,707 (GRCm39) utr 3 prime probably benign
R0510:Col11a1 UTSW 3 113,899,105 (GRCm39) splice site probably benign
R0535:Col11a1 UTSW 3 113,855,184 (GRCm39) missense unknown
R0608:Col11a1 UTSW 3 114,012,364 (GRCm39) utr 3 prime probably benign
R0826:Col11a1 UTSW 3 113,932,414 (GRCm39) missense unknown
R0827:Col11a1 UTSW 3 113,932,414 (GRCm39) missense unknown
R0862:Col11a1 UTSW 3 113,932,414 (GRCm39) missense unknown
R0863:Col11a1 UTSW 3 113,932,414 (GRCm39) missense unknown
R0926:Col11a1 UTSW 3 113,883,829 (GRCm39) missense unknown
R0980:Col11a1 UTSW 3 113,932,414 (GRCm39) missense unknown
R0981:Col11a1 UTSW 3 113,932,414 (GRCm39) missense unknown
R1004:Col11a1 UTSW 3 113,888,671 (GRCm39) splice site probably benign
R1037:Col11a1 UTSW 3 113,987,801 (GRCm39) missense probably damaging 1.00
R1171:Col11a1 UTSW 3 113,860,213 (GRCm39) missense unknown
R1316:Col11a1 UTSW 3 113,932,619 (GRCm39) splice site probably null
R1324:Col11a1 UTSW 3 113,824,565 (GRCm39) missense unknown
R1338:Col11a1 UTSW 3 114,010,644 (GRCm39) utr 3 prime probably benign
R1513:Col11a1 UTSW 3 113,890,803 (GRCm39) missense unknown
R1528:Col11a1 UTSW 3 114,010,644 (GRCm39) utr 3 prime probably benign
R1567:Col11a1 UTSW 3 113,932,261 (GRCm39) missense unknown
R1596:Col11a1 UTSW 3 113,946,262 (GRCm39) utr 3 prime probably benign
R1605:Col11a1 UTSW 3 113,925,290 (GRCm39) missense probably damaging 1.00
R1624:Col11a1 UTSW 3 113,951,804 (GRCm39) missense probably damaging 0.97
R1626:Col11a1 UTSW 3 113,925,218 (GRCm39) missense probably damaging 1.00
R1666:Col11a1 UTSW 3 113,855,184 (GRCm39) missense unknown
R1806:Col11a1 UTSW 3 113,951,791 (GRCm39) missense probably damaging 1.00
R2001:Col11a1 UTSW 3 113,958,942 (GRCm39) splice site probably null
R2084:Col11a1 UTSW 3 113,951,791 (GRCm39) missense probably damaging 1.00
R2085:Col11a1 UTSW 3 113,951,791 (GRCm39) missense probably damaging 1.00
R3926:Col11a1 UTSW 3 113,883,773 (GRCm39) splice site probably benign
R3950:Col11a1 UTSW 3 113,915,094 (GRCm39) critical splice donor site probably null
R3970:Col11a1 UTSW 3 113,890,838 (GRCm39) missense unknown
R4171:Col11a1 UTSW 3 114,001,863 (GRCm39) missense probably damaging 0.99
R4175:Col11a1 UTSW 3 114,001,872 (GRCm39) missense possibly damaging 0.83
R4176:Col11a1 UTSW 3 114,001,872 (GRCm39) missense possibly damaging 0.83
R4413:Col11a1 UTSW 3 113,901,965 (GRCm39) missense unknown
R4540:Col11a1 UTSW 3 113,890,815 (GRCm39) missense unknown
R5210:Col11a1 UTSW 3 113,946,806 (GRCm39) missense probably damaging 1.00
R5250:Col11a1 UTSW 3 114,010,819 (GRCm39) utr 3 prime probably benign
R5335:Col11a1 UTSW 3 113,888,889 (GRCm39) missense unknown
R5344:Col11a1 UTSW 3 114,002,011 (GRCm39) critical splice donor site probably null
R5394:Col11a1 UTSW 3 113,987,833 (GRCm39) splice site probably null
R5687:Col11a1 UTSW 3 114,010,752 (GRCm39) utr 3 prime probably benign
R5708:Col11a1 UTSW 3 113,890,743 (GRCm39) missense unknown
R5763:Col11a1 UTSW 3 113,888,245 (GRCm39) intron probably benign
R5792:Col11a1 UTSW 3 113,925,242 (GRCm39) missense probably damaging 1.00
R6259:Col11a1 UTSW 3 113,932,096 (GRCm39) missense probably benign
R6679:Col11a1 UTSW 3 113,946,368 (GRCm39) splice site probably null
R6738:Col11a1 UTSW 3 113,906,116 (GRCm39) unclassified probably benign
R6747:Col11a1 UTSW 3 114,006,099 (GRCm39) nonsense probably null
R6808:Col11a1 UTSW 3 113,888,593 (GRCm39) missense possibly damaging 0.87
R6861:Col11a1 UTSW 3 113,961,141 (GRCm39) missense probably damaging 1.00
R7201:Col11a1 UTSW 3 113,883,806 (GRCm39) missense unknown
R7264:Col11a1 UTSW 3 113,979,248 (GRCm39) missense unknown
R7393:Col11a1 UTSW 3 113,890,755 (GRCm39) missense unknown
R7445:Col11a1 UTSW 3 113,987,578 (GRCm39) missense unknown
R7479:Col11a1 UTSW 3 113,896,218 (GRCm39) missense unknown
R7548:Col11a1 UTSW 3 113,917,409 (GRCm39) missense unknown
R7683:Col11a1 UTSW 3 113,907,385 (GRCm39) missense unknown
R7747:Col11a1 UTSW 3 113,896,221 (GRCm39) missense unknown
R7809:Col11a1 UTSW 3 113,890,835 (GRCm39) missense unknown
R7951:Col11a1 UTSW 3 113,888,864 (GRCm39) missense unknown
R8057:Col11a1 UTSW 3 113,925,263 (GRCm39) missense unknown
R8134:Col11a1 UTSW 3 114,012,435 (GRCm39) missense unknown
R8139:Col11a1 UTSW 3 113,890,698 (GRCm39) missense unknown
R8243:Col11a1 UTSW 3 113,855,141 (GRCm39) missense unknown
R8324:Col11a1 UTSW 3 113,958,059 (GRCm39) missense probably damaging 1.00
R8346:Col11a1 UTSW 3 114,005,818 (GRCm39) missense unknown
R9113:Col11a1 UTSW 3 113,888,192 (GRCm39) nonsense probably null
R9122:Col11a1 UTSW 3 113,907,249 (GRCm39) missense unknown
R9137:Col11a1 UTSW 3 113,855,172 (GRCm39) missense unknown
R9224:Col11a1 UTSW 3 114,001,929 (GRCm39) missense unknown
R9264:Col11a1 UTSW 3 114,005,809 (GRCm39) missense unknown
R9272:Col11a1 UTSW 3 113,901,948 (GRCm39) nonsense probably null
R9382:Col11a1 UTSW 3 113,899,046 (GRCm39) missense unknown
R9492:Col11a1 UTSW 3 114,005,752 (GRCm39) missense probably benign 0.39
RF002:Col11a1 UTSW 3 114,010,650 (GRCm39) missense unknown
X0018:Col11a1 UTSW 3 113,905,882 (GRCm39) unclassified probably benign
Z1177:Col11a1 UTSW 3 113,958,884 (GRCm39) critical splice acceptor site probably null
Z1177:Col11a1 UTSW 3 113,932,570 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCACTGTGTAAAGGGTCATTTGC -3'
(R):5'- GACACGTTCATGGGAAAAGTC -3'

Sequencing Primer
(F):5'- CTAGCATGTTGATAACCCTGATGTGC -3'
(R):5'- GACACGTTCATGGGAAAAGTCATTTG -3'
Posted On 2021-01-18