Incidental Mutation 'R8480:Szt2'
ID 657467
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name SZT2 subunit of KICSTOR complex
Synonyms seaizure threshold 2
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.610) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 118219940-118266470 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 118244015 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1363 (S1363R)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075406
AA Change: S1363R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: S1363R

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b G A 15: 101,108,720 (GRCm39) V499M possibly damaging Het
Adam5 G A 8: 25,294,475 (GRCm39) Q375* probably null Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Aste1 G A 9: 105,274,189 (GRCm39) R143Q possibly damaging Het
Aste1 A T 9: 105,274,995 (GRCm39) T351S probably damaging Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Cdh22 T A 2: 164,988,646 (GRCm39) E236D probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col11a1 A G 3: 113,975,043 (GRCm39) D1234G probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dlec1 G A 9: 118,972,335 (GRCm39) probably null Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm4787 T A 12: 81,424,280 (GRCm39) D626V probably damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Krt36 T C 11: 99,993,635 (GRCm39) D401G possibly damaging Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Lrrc8b A G 5: 105,633,802 (GRCm39) N758S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Or4f14d A T 2: 111,960,330 (GRCm39) D275E possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Recql4 G T 15: 76,588,705 (GRCm39) H1035Q probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sh3d19 T G 3: 85,992,184 (GRCm39) W71G probably benign Het
Sidt1 T C 16: 44,065,529 (GRCm39) Y759C probably damaging Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Ssc5d A T 7: 4,939,328 (GRCm39) D588V probably damaging Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zfp473 G T 7: 44,382,323 (GRCm39) P670Q probably damaging Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118,241,447 (GRCm39) splice site probably benign
IGL01082:Szt2 APN 4 118,254,821 (GRCm39) missense probably damaging 1.00
IGL01348:Szt2 APN 4 118,250,821 (GRCm39) splice site probably benign
IGL01869:Szt2 APN 4 118,256,268 (GRCm39) missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118,241,450 (GRCm39) splice site probably benign
IGL01951:Szt2 APN 4 118,233,690 (GRCm39) unclassified probably benign
IGL01971:Szt2 APN 4 118,244,152 (GRCm39) missense probably benign 0.01
IGL02047:Szt2 APN 4 118,233,834 (GRCm39) unclassified probably benign
IGL02092:Szt2 APN 4 118,220,529 (GRCm39) unclassified probably benign
IGL02120:Szt2 APN 4 118,245,761 (GRCm39) missense probably benign 0.01
IGL02210:Szt2 APN 4 118,247,020 (GRCm39) missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118,248,020 (GRCm39) missense probably damaging 1.00
IGL02622:Szt2 APN 4 118,250,087 (GRCm39) missense probably damaging 0.96
IGL02666:Szt2 APN 4 118,231,252 (GRCm39) missense probably damaging 0.99
IGL02712:Szt2 APN 4 118,242,030 (GRCm39) missense probably benign 0.19
IGL02983:Szt2 APN 4 118,222,976 (GRCm39) unclassified probably benign
IGL03026:Szt2 APN 4 118,249,046 (GRCm39) missense probably benign 0.40
IGL03178:Szt2 APN 4 118,239,886 (GRCm39) missense unknown
IGL03233:Szt2 APN 4 118,229,726 (GRCm39) missense unknown
IGL03377:Szt2 APN 4 118,259,594 (GRCm39) splice site probably benign
IGL03387:Szt2 APN 4 118,221,922 (GRCm39) unclassified probably benign
PIT4687001:Szt2 UTSW 4 118,255,398 (GRCm39) missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118,241,969 (GRCm39) missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118,239,790 (GRCm39) missense unknown
R0396:Szt2 UTSW 4 118,233,544 (GRCm39) unclassified probably benign
R0504:Szt2 UTSW 4 118,230,149 (GRCm39) splice site probably null
R1033:Szt2 UTSW 4 118,244,303 (GRCm39) missense probably damaging 0.98
R1222:Szt2 UTSW 4 118,262,656 (GRCm39) missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118,244,976 (GRCm39) missense probably benign 0.03
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1763:Szt2 UTSW 4 118,229,565 (GRCm39) missense unknown
R1772:Szt2 UTSW 4 118,262,714 (GRCm39) missense probably damaging 1.00
R1840:Szt2 UTSW 4 118,222,854 (GRCm39) unclassified probably benign
R1942:Szt2 UTSW 4 118,249,817 (GRCm39) missense probably benign 0.17
R1965:Szt2 UTSW 4 118,241,162 (GRCm39) missense probably benign 0.36
R1998:Szt2 UTSW 4 118,232,924 (GRCm39) critical splice donor site probably null
R2009:Szt2 UTSW 4 118,235,261 (GRCm39) critical splice donor site probably null
R2012:Szt2 UTSW 4 118,220,862 (GRCm39) unclassified probably benign
R2044:Szt2 UTSW 4 118,233,645 (GRCm39) nonsense probably null
R2066:Szt2 UTSW 4 118,231,177 (GRCm39) missense unknown
R2345:Szt2 UTSW 4 118,238,594 (GRCm39) missense unknown
R2857:Szt2 UTSW 4 118,226,599 (GRCm39) missense probably damaging 1.00
R3156:Szt2 UTSW 4 118,260,016 (GRCm39) critical splice donor site probably null
R3236:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3237:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3405:Szt2 UTSW 4 118,251,217 (GRCm39) missense probably benign 0.02
R3795:Szt2 UTSW 4 118,248,927 (GRCm39) missense probably damaging 1.00
R3878:Szt2 UTSW 4 118,247,782 (GRCm39) missense probably damaging 1.00
R3906:Szt2 UTSW 4 118,235,466 (GRCm39) unclassified probably benign
R4012:Szt2 UTSW 4 118,241,097 (GRCm39) missense probably benign 0.02
R4039:Szt2 UTSW 4 118,222,149 (GRCm39) unclassified probably benign
R4081:Szt2 UTSW 4 118,230,764 (GRCm39) splice site probably benign
R4298:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4299:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4432:Szt2 UTSW 4 118,241,428 (GRCm39) missense probably damaging 0.99
R4597:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R4657:Szt2 UTSW 4 118,254,866 (GRCm39) missense probably benign 0.06
R4663:Szt2 UTSW 4 118,234,881 (GRCm39) unclassified probably benign
R4670:Szt2 UTSW 4 118,233,026 (GRCm39) unclassified probably benign
R4704:Szt2 UTSW 4 118,251,026 (GRCm39) missense probably damaging 0.99
R4748:Szt2 UTSW 4 118,246,388 (GRCm39) nonsense probably null
R4786:Szt2 UTSW 4 118,256,259 (GRCm39) missense probably benign 0.20
R4809:Szt2 UTSW 4 118,246,182 (GRCm39) missense probably damaging 1.00
R4830:Szt2 UTSW 4 118,226,445 (GRCm39) missense unknown
R4944:Szt2 UTSW 4 118,245,866 (GRCm39) missense probably benign 0.03
R5077:Szt2 UTSW 4 118,226,813 (GRCm39) critical splice donor site probably null
R5121:Szt2 UTSW 4 118,242,641 (GRCm39) missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118,244,178 (GRCm39) missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118,247,027 (GRCm39) missense probably benign 0.26
R5198:Szt2 UTSW 4 118,245,519 (GRCm39) missense probably benign 0.03
R5433:Szt2 UTSW 4 118,232,663 (GRCm39) unclassified probably benign
R5625:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5628:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5630:Szt2 UTSW 4 118,250,102 (GRCm39) missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118,229,810 (GRCm39) missense unknown
R5902:Szt2 UTSW 4 118,248,700 (GRCm39) missense probably benign 0.05
R6049:Szt2 UTSW 4 118,260,185 (GRCm39) missense probably damaging 0.99
R6066:Szt2 UTSW 4 118,229,171 (GRCm39) missense unknown
R6272:Szt2 UTSW 4 118,231,487 (GRCm39) unclassified probably benign
R6456:Szt2 UTSW 4 118,233,894 (GRCm39) unclassified probably benign
R6538:Szt2 UTSW 4 118,247,674 (GRCm39) splice site probably null
R6604:Szt2 UTSW 4 118,242,671 (GRCm39) missense probably benign 0.01
R6664:Szt2 UTSW 4 118,248,942 (GRCm39) missense probably damaging 1.00
R6834:Szt2 UTSW 4 118,245,522 (GRCm39) missense probably benign 0.01
R7109:Szt2 UTSW 4 118,232,676 (GRCm39) missense unknown
R7163:Szt2 UTSW 4 118,262,727 (GRCm39) missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118,246,203 (GRCm39) missense probably damaging 0.98
R7289:Szt2 UTSW 4 118,233,075 (GRCm39) missense unknown
R7291:Szt2 UTSW 4 118,248,446 (GRCm39) missense probably damaging 0.98
R7383:Szt2 UTSW 4 118,222,411 (GRCm39) nonsense probably null
R7448:Szt2 UTSW 4 118,220,668 (GRCm39) missense unknown
R7637:Szt2 UTSW 4 118,251,025 (GRCm39) missense probably damaging 0.99
R7833:Szt2 UTSW 4 118,223,416 (GRCm39) missense unknown
R7896:Szt2 UTSW 4 118,260,110 (GRCm39) missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118,231,037 (GRCm39) missense unknown
R8090:Szt2 UTSW 4 118,244,199 (GRCm39) splice site probably null
R8103:Szt2 UTSW 4 118,245,061 (GRCm39) missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118,246,973 (GRCm39) missense probably damaging 0.96
R8309:Szt2 UTSW 4 118,232,679 (GRCm39) frame shift probably null
R8341:Szt2 UTSW 4 118,250,033 (GRCm39) missense possibly damaging 0.63
R8497:Szt2 UTSW 4 118,245,518 (GRCm39) missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R8768:Szt2 UTSW 4 118,226,613 (GRCm39) missense unknown
R8992:Szt2 UTSW 4 118,239,985 (GRCm39) splice site probably benign
R9001:Szt2 UTSW 4 118,235,529 (GRCm39) missense unknown
R9094:Szt2 UTSW 4 118,242,651 (GRCm39) missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118,242,630 (GRCm39) missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118,221,866 (GRCm39) missense unknown
R9184:Szt2 UTSW 4 118,241,726 (GRCm39) missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118,242,288 (GRCm39) missense probably damaging 1.00
R9424:Szt2 UTSW 4 118,248,151 (GRCm39) missense probably damaging 1.00
R9598:Szt2 UTSW 4 118,266,358 (GRCm39) critical splice donor site probably null
X0023:Szt2 UTSW 4 118,229,601 (GRCm39) missense unknown
Z1176:Szt2 UTSW 4 118,251,173 (GRCm39) missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118,248,411 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGTGACAAGGTACCAC -3'
(R):5'- GGTGATCCTCATGACCCATTCTG -3'

Sequencing Primer
(F):5'- GTGACAAGGTACCACTGCTTC -3'
(R):5'- CTTCCATTAGGGCTGTTCCGAAG -3'
Posted On 2021-01-18