Mutagenetix > Incidental Mutation

Incidental Mutation 'R8480:Szt2'

657467

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.539) question?

Stock #

R8480 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 118386818 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1363 (S1363R)

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000075406
AA Change: S1363R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: S1363R

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,187,458	P720Q	possibly damaging	Het
Acvr1b	G	A	15: 101,210,839	V499M	possibly damaging	Het
Adam5	G	A	8: 24,804,459	Q375*	probably null	Het
Adgrf1	G	A	17: 43,295,164	E60K	probably benign	Het
Alb	T	C	5: 90,462,771	V70A	probably damaging	Het
Aph1b	T	A	9: 66,788,427		probably benign	Het
Aste1	G	A	9: 105,396,990	R143Q	possibly damaging	Het
Aste1	A	T	9: 105,397,796	T351S	probably damaging	Het
Bace2	T	A	16: 97,413,470	L286Q	probably damaging	Het
Bach1	G	A	16: 87,719,275	G235R	probably damaging	Het
Brwd1	A	T	16: 96,047,430	H516Q	probably damaging	Het
Cc2d2a	C	A	5: 43,685,144		probably null	Het
Cdh22	T	A	2: 165,146,726	E236D	probably benign	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Celsr2	T	A	3: 108,398,902	T2029S	probably benign	Het
Col11a1	A	G	3: 114,181,394	D1234G	probably benign	Het
Cpt2	A	G	4: 107,907,760	I269T	probably damaging	Het
Dcaf7	T	A	11: 106,054,793	S323T	probably benign	Het
Ddias	G	T	7: 92,859,400	Q436K	probably benign	Het
Dlec1	G	A	9: 119,143,267		probably null	Het
Dock5	T	A	14: 67,836,410	I294F	probably benign	Het
Fat2	A	T	11: 55,282,968	D2306E	possibly damaging	Het
Gm4787	T	A	12: 81,377,506	D626V	probably damaging	Het
Gm6563	A	G	19: 23,675,926	T27A	probably benign	Het
Hadhb	T	C	5: 30,168,570		probably null	Het
Hsph1	A	T	5: 149,627,564	W406R	probably null	Het
Ighv1-66	C	T	12: 115,593,382	G27R	possibly damaging	Het
Impad1	C	T	4: 4,769,376	M246I	probably benign	Het
Krt26	T	C	11: 99,337,600	E102G	probably damaging	Het
Krt34	T	A	11: 100,040,145		probably null	Het
Krt36	T	C	11: 100,102,809	D401G	possibly damaging	Het
Loxhd1	G	A	18: 77,431,131	G326S	probably damaging	Het
Lrrc8b	A	G	5: 105,485,936	N758S	probably damaging	Het
Mkl2	A	T	16: 13,384,192		probably null	Het
Muc4	C	T	16: 32,752,993	T957I	probably benign	Het
Naip5	T	C	13: 100,222,235	Y831C	probably damaging	Het
Nfatc1	A	T	18: 80,635,644	V829E	probably benign	Het
Nmnat1	G	A	4: 149,473,370	L72F	possibly damaging	Het
Olfr1316	A	T	2: 112,129,985	D275E	possibly damaging	Het
Pcdh7	T	A	5: 58,129,065	V1161E	probably damaging	Het
Raver1	A	G	9: 21,090,280	Y86H	probably benign	Het
Recql4	G	T	15: 76,704,505	H1035Q	probably benign	Het
Sgsm1	A	T	5: 113,263,418	M814K	probably benign	Het
Sh3d19	T	G	3: 86,084,877	W71G	probably benign	Het
Sidt1	T	C	16: 44,245,166	Y759C	probably damaging	Het
Spg11	G	T	2: 122,113,079	D197E	probably damaging	Het
Sppl2b	TGTCACAGGT	TGT	10: 80,866,069		probably null	Het
Ssc5d	A	T	7: 4,936,329	D588V	probably damaging	Het
Supt20	C	A	3: 54,707,116	T181K	probably damaging	Het
Tbcel	G	A	9: 42,463,873		probably null	Het
Ube2e3	T	C	2: 78,918,814	L169P	probably damaging	Het
Wrn	A	G	8: 33,288,768	F595S	probably benign	Het
Zfp473	G	T	7: 44,732,899	P670Q	probably damaging	Het
Zw10	C	T	9: 49,074,999	A660V	probably benign	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCAGTGACAAGGTACCAC -3'
(R):5'- GGTGATCCTCATGACCCATTCTG -3'

Sequencing Primer
(F):5'- GTGACAAGGTACCACTGCTTC -3'
(R):5'- CTTCCATTAGGGCTGTTCCGAAG -3'

Posted On

2021-01-18