Incidental Mutation 'R8480:Lrrc8b'
ID 657472
Institutional Source Beutler Lab
Gene Symbol Lrrc8b
Ensembl Gene ENSMUSG00000070639
Gene Name leucine rich repeat containing 8 family, member B
Synonyms R75581, 2210408K08Rik
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.200) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 105563641-105637940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105633802 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 758 (N758S)
Ref Sequence ENSEMBL: ENSMUSP00000108327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112707]
AlphaFold Q5DU41
Predicted Effect probably damaging
Transcript: ENSMUST00000112707
AA Change: N758S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108327
Gene: ENSMUSG00000070639
AA Change: N758S

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 334 2.9e-133 PFAM
LRR 509 536 5.27e1 SMART
LRR 584 607 2.03e1 SMART
LRR 632 654 1.97e1 SMART
LRR_TYP 655 678 4.79e-3 SMART
LRR 679 700 3.09e1 SMART
LRR_TYP 701 724 4.17e-3 SMART
LRR 747 770 2.17e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b G A 15: 101,108,720 (GRCm39) V499M possibly damaging Het
Adam5 G A 8: 25,294,475 (GRCm39) Q375* probably null Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Aste1 G A 9: 105,274,189 (GRCm39) R143Q possibly damaging Het
Aste1 A T 9: 105,274,995 (GRCm39) T351S probably damaging Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Cdh22 T A 2: 164,988,646 (GRCm39) E236D probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col11a1 A G 3: 113,975,043 (GRCm39) D1234G probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dlec1 G A 9: 118,972,335 (GRCm39) probably null Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm4787 T A 12: 81,424,280 (GRCm39) D626V probably damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Krt36 T C 11: 99,993,635 (GRCm39) D401G possibly damaging Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Or4f14d A T 2: 111,960,330 (GRCm39) D275E possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Recql4 G T 15: 76,588,705 (GRCm39) H1035Q probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sh3d19 T G 3: 85,992,184 (GRCm39) W71G probably benign Het
Sidt1 T C 16: 44,065,529 (GRCm39) Y759C probably damaging Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Ssc5d A T 7: 4,939,328 (GRCm39) D588V probably damaging Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Szt2 A T 4: 118,244,015 (GRCm39) S1363R probably benign Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zfp473 G T 7: 44,382,323 (GRCm39) P670Q probably damaging Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Lrrc8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Lrrc8b APN 5 105,628,365 (GRCm39) missense probably damaging 0.96
IGL00519:Lrrc8b APN 5 105,629,591 (GRCm39) missense possibly damaging 0.82
IGL01732:Lrrc8b APN 5 105,633,826 (GRCm39) missense probably damaging 1.00
IGL01799:Lrrc8b APN 5 105,633,757 (GRCm39) missense probably benign
IGL02005:Lrrc8b APN 5 105,628,920 (GRCm39) missense probably benign 0.22
IGL02205:Lrrc8b APN 5 105,629,703 (GRCm39) missense probably benign 0.07
IGL03038:Lrrc8b APN 5 105,629,358 (GRCm39) missense probably damaging 0.98
IGL03076:Lrrc8b APN 5 105,629,415 (GRCm39) missense probably damaging 1.00
sospecho UTSW 5 105,628,622 (GRCm39) missense probably damaging 1.00
Whiff UTSW 5 105,628,137 (GRCm39) missense possibly damaging 0.80
IGL02796:Lrrc8b UTSW 5 105,629,211 (GRCm39) missense probably damaging 1.00
R0647:Lrrc8b UTSW 5 105,628,473 (GRCm39) missense possibly damaging 0.69
R0722:Lrrc8b UTSW 5 105,627,978 (GRCm39) missense possibly damaging 0.89
R1382:Lrrc8b UTSW 5 105,628,749 (GRCm39) missense probably damaging 1.00
R1437:Lrrc8b UTSW 5 105,629,568 (GRCm39) missense probably damaging 1.00
R1801:Lrrc8b UTSW 5 105,628,689 (GRCm39) missense probably damaging 1.00
R1888:Lrrc8b UTSW 5 105,629,217 (GRCm39) missense probably benign 0.12
R1888:Lrrc8b UTSW 5 105,629,217 (GRCm39) missense probably benign 0.12
R2169:Lrrc8b UTSW 5 105,629,753 (GRCm39) missense probably damaging 0.99
R4514:Lrrc8b UTSW 5 105,627,819 (GRCm39) missense probably damaging 1.00
R4898:Lrrc8b UTSW 5 105,628,080 (GRCm39) missense probably benign 0.19
R5243:Lrrc8b UTSW 5 105,628,812 (GRCm39) missense probably damaging 1.00
R5264:Lrrc8b UTSW 5 105,628,118 (GRCm39) missense probably damaging 0.98
R5424:Lrrc8b UTSW 5 105,628,569 (GRCm39) missense probably damaging 1.00
R5513:Lrrc8b UTSW 5 105,633,850 (GRCm39) missense probably damaging 1.00
R5632:Lrrc8b UTSW 5 105,628,163 (GRCm39) missense possibly damaging 0.81
R5799:Lrrc8b UTSW 5 105,629,208 (GRCm39) missense probably benign 0.19
R5800:Lrrc8b UTSW 5 105,629,208 (GRCm39) missense probably benign 0.19
R6637:Lrrc8b UTSW 5 105,628,137 (GRCm39) missense possibly damaging 0.80
R7249:Lrrc8b UTSW 5 105,629,133 (GRCm39) missense probably benign 0.23
R7253:Lrrc8b UTSW 5 105,629,522 (GRCm39) missense probably benign 0.01
R7558:Lrrc8b UTSW 5 105,629,577 (GRCm39) missense probably damaging 1.00
R8077:Lrrc8b UTSW 5 105,627,883 (GRCm39) missense possibly damaging 0.48
R8423:Lrrc8b UTSW 5 105,628,622 (GRCm39) missense probably damaging 1.00
R8765:Lrrc8b UTSW 5 105,629,133 (GRCm39) missense probably benign
R8841:Lrrc8b UTSW 5 105,628,188 (GRCm39) missense probably benign 0.00
R8912:Lrrc8b UTSW 5 105,629,424 (GRCm39) missense probably damaging 1.00
R9040:Lrrc8b UTSW 5 105,628,161 (GRCm39) missense probably benign 0.02
R9432:Lrrc8b UTSW 5 105,633,888 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GTACGTGAATGTGCTGCTAGAG -3'
(R):5'- GAAAGTTCATCCTCCTATCCCGG -3'

Sequencing Primer
(F):5'- GCTGCTAGAGCCAGTCAAAAC -3'
(R):5'- ATCCCGGGGCCTCTTTAGAAC -3'
Posted On 2021-01-18