Mutagenetix > Incidental Mutation

Incidental Mutation 'R8480:Ssc5d'

657475

Institutional Source

Beutler Lab

Gene Symbol

Ssc5d

Ensembl Gene

ENSMUSG00000035279

Gene Name

scavenger receptor cysteine rich family, 5 domains

Synonyms

s5d-srcrb, A430110N23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8480 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4925785-4944826 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 4936329 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 588 (D588V)

Ref Sequence

ENSEMBL: ENSMUSP00000052126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057612] [ENSMUST00000208109]

AlphaFold

Q8BV57

Predicted Effect

probably damaging
Transcript: ENSMUST00000057612
AA Change: D588V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279
AA Change: D588V

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SR	20	120	4.44e-49	SMART
low complexity region	141	155	N/A	INTRINSIC
low complexity region	167	182	N/A	INTRINSIC
SR	199	299	2.36e-53	SMART
SR	305	405	8.22e-53	SMART
low complexity region	437	462	N/A	INTRINSIC
SR	464	565	1.11e-49	SMART
low complexity region	741	755	N/A	INTRINSIC
SR	758	858	3.93e-50	SMART
low complexity region	936	957	N/A	INTRINSIC
low complexity region	981	1004	N/A	INTRINSIC
low complexity region	1018	1035	N/A	INTRINSIC
low complexity region	1218	1230	N/A	INTRINSIC
low complexity region	1357	1364	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208109

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (53/54)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,187,458	P720Q	possibly damaging	Het
Acvr1b	G	A	15: 101,210,839	V499M	possibly damaging	Het
Adam5	G	A	8: 24,804,459	Q375*	probably null	Het
Adgrf1	G	A	17: 43,295,164	E60K	probably benign	Het
Alb	T	C	5: 90,462,771	V70A	probably damaging	Het
Aph1b	T	A	9: 66,788,427		probably benign	Het
Aste1	G	A	9: 105,396,990	R143Q	possibly damaging	Het
Aste1	A	T	9: 105,397,796	T351S	probably damaging	Het
Bace2	T	A	16: 97,413,470	L286Q	probably damaging	Het
Bach1	G	A	16: 87,719,275	G235R	probably damaging	Het
Brwd1	A	T	16: 96,047,430	H516Q	probably damaging	Het
Cc2d2a	C	A	5: 43,685,144		probably null	Het
Cdh22	T	A	2: 165,146,726	E236D	probably benign	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Celsr2	T	A	3: 108,398,902	T2029S	probably benign	Het
Col11a1	A	G	3: 114,181,394	D1234G	probably benign	Het
Cpt2	A	G	4: 107,907,760	I269T	probably damaging	Het
Dcaf7	T	A	11: 106,054,793	S323T	probably benign	Het
Ddias	G	T	7: 92,859,400	Q436K	probably benign	Het
Dlec1	G	A	9: 119,143,267		probably null	Het
Dock5	T	A	14: 67,836,410	I294F	probably benign	Het
Fat2	A	T	11: 55,282,968	D2306E	possibly damaging	Het
Gm4787	T	A	12: 81,377,506	D626V	probably damaging	Het
Gm6563	A	G	19: 23,675,926	T27A	probably benign	Het
Hadhb	T	C	5: 30,168,570		probably null	Het
Hsph1	A	T	5: 149,627,564	W406R	probably null	Het
Ighv1-66	C	T	12: 115,593,382	G27R	possibly damaging	Het
Impad1	C	T	4: 4,769,376	M246I	probably benign	Het
Krt26	T	C	11: 99,337,600	E102G	probably damaging	Het
Krt34	T	A	11: 100,040,145		probably null	Het
Krt36	T	C	11: 100,102,809	D401G	possibly damaging	Het
Loxhd1	G	A	18: 77,431,131	G326S	probably damaging	Het
Lrrc8b	A	G	5: 105,485,936	N758S	probably damaging	Het
Mkl2	A	T	16: 13,384,192		probably null	Het
Muc4	C	T	16: 32,752,993	T957I	probably benign	Het
Naip5	T	C	13: 100,222,235	Y831C	probably damaging	Het
Nfatc1	A	T	18: 80,635,644	V829E	probably benign	Het
Nmnat1	G	A	4: 149,473,370	L72F	possibly damaging	Het
Olfr1316	A	T	2: 112,129,985	D275E	possibly damaging	Het
Pcdh7	T	A	5: 58,129,065	V1161E	probably damaging	Het
Raver1	A	G	9: 21,090,280	Y86H	probably benign	Het
Recql4	G	T	15: 76,704,505	H1035Q	probably benign	Het
Sgsm1	A	T	5: 113,263,418	M814K	probably benign	Het
Sh3d19	T	G	3: 86,084,877	W71G	probably benign	Het
Sidt1	T	C	16: 44,245,166	Y759C	probably damaging	Het
Spg11	G	T	2: 122,113,079	D197E	probably damaging	Het
Sppl2b	TGTCACAGGT	TGT	10: 80,866,069		probably null	Het
Supt20	C	A	3: 54,707,116	T181K	probably damaging	Het
Szt2	A	T	4: 118,386,818	S1363R	probably benign	Het
Tbcel	G	A	9: 42,463,873		probably null	Het
Ube2e3	T	C	2: 78,918,814	L169P	probably damaging	Het
Wrn	A	G	8: 33,288,768	F595S	probably benign	Het
Zfp473	G	T	7: 44,732,899	P670Q	probably damaging	Het
Zw10	C	T	9: 49,074,999	A660V	probably benign	Het

Other mutations in Ssc5d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Ssc5d	APN	7	4944481	missense	possibly damaging	0.63
IGL00939:Ssc5d	APN	7	4936281	missense	possibly damaging	0.89
IGL01109:Ssc5d	APN	7	4937112	nonsense	probably null
IGL01409:Ssc5d	APN	7	4942809	missense	probably benign	0.16
IGL01880:Ssc5d	APN	7	4933219	missense	probably damaging	1.00
IGL02013:Ssc5d	APN	7	4943836	missense	probably benign	0.00
IGL02227:Ssc5d	APN	7	4933454	critical splice donor site	probably null
IGL02963:Ssc5d	APN	7	4944327	missense	probably benign	0.02
D4043:Ssc5d	UTSW	7	4943983	missense	possibly damaging	0.70
D4216:Ssc5d	UTSW	7	4943983	missense	possibly damaging	0.70
R0104:Ssc5d	UTSW	7	4936286	missense	probably benign	0.41
R0115:Ssc5d	UTSW	7	4927881	unclassified	probably benign
R0201:Ssc5d	UTSW	7	4944663	missense	probably benign
R0365:Ssc5d	UTSW	7	4928467	nonsense	probably null
R0485:Ssc5d	UTSW	7	4937471	missense	probably damaging	0.99
R0967:Ssc5d	UTSW	7	4944343	nonsense	probably null
R1607:Ssc5d	UTSW	7	4944043	missense	probably benign	0.25
R1639:Ssc5d	UTSW	7	4928417	missense	probably damaging	1.00
R1801:Ssc5d	UTSW	7	4936607	missense	probably benign	0.05
R1867:Ssc5d	UTSW	7	4928507	missense	probably damaging	1.00
R1999:Ssc5d	UTSW	7	4942714	missense	possibly damaging	0.86
R2007:Ssc5d	UTSW	7	4928629	missense	probably damaging	1.00
R2084:Ssc5d	UTSW	7	4937012	missense	probably benign	0.01
R2234:Ssc5d	UTSW	7	4943850	missense	probably benign
R2259:Ssc5d	UTSW	7	4943916	missense	probably benign	0.01
R2567:Ssc5d	UTSW	7	4936335	missense	probably damaging	1.00
R2879:Ssc5d	UTSW	7	4936907	critical splice acceptor site	probably null
R3782:Ssc5d	UTSW	7	4942791	missense	probably benign	0.00
R3875:Ssc5d	UTSW	7	4927262	missense	probably damaging	1.00
R4322:Ssc5d	UTSW	7	4928450	missense	probably damaging	1.00
R4331:Ssc5d	UTSW	7	4942726	missense	probably benign	0.00
R4334:Ssc5d	UTSW	7	4943664	missense	probably benign
R4430:Ssc5d	UTSW	7	4943664	missense	probably benign
R4619:Ssc5d	UTSW	7	4929525	missense	probably damaging	1.00
R4794:Ssc5d	UTSW	7	4943745	missense	probably benign
R5106:Ssc5d	UTSW	7	4936665	missense	probably benign	0.31
R5174:Ssc5d	UTSW	7	4927971	missense	possibly damaging	0.83
R5553:Ssc5d	UTSW	7	4936290	missense	probably damaging	1.00
R5649:Ssc5d	UTSW	7	4926518	critical splice donor site	probably null
R5786:Ssc5d	UTSW	7	4936818	missense	probably benign	0.00
R6059:Ssc5d	UTSW	7	4942744	missense	possibly damaging	0.86
R6163:Ssc5d	UTSW	7	4927254	missense	probably damaging	1.00
R6332:Ssc5d	UTSW	7	4937522	missense	probably damaging	1.00
R6341:Ssc5d	UTSW	7	4936665	missense	probably benign	0.31
R6613:Ssc5d	UTSW	7	4933293	missense	possibly damaging	0.82
R7180:Ssc5d	UTSW	7	4936601	missense	probably benign	0.17
R7576:Ssc5d	UTSW	7	4928573	missense	probably damaging	1.00
R7602:Ssc5d	UTSW	7	4942746	missense	possibly damaging	0.95
R7609:Ssc5d	UTSW	7	4927576	missense	possibly damaging	0.56
R7691:Ssc5d	UTSW	7	4944169	missense	probably benign	0.29
R7759:Ssc5d	UTSW	7	4937530	nonsense	probably null
R9029:Ssc5d	UTSW	7	4927920	missense	probably damaging	0.97
R9163:Ssc5d	UTSW	7	4933433	missense	probably damaging	1.00
R9178:Ssc5d	UTSW	7	4927059	missense	probably damaging	1.00
R9181:Ssc5d	UTSW	7	4942815	missense	possibly damaging	0.86
R9382:Ssc5d	UTSW	7	4927284	critical splice donor site	probably null
R9489:Ssc5d	UTSW	7	4937600	missense	probably benign	0.02
R9626:Ssc5d	UTSW	7	4943569	missense	probably benign
R9630:Ssc5d	UTSW	7	4936427	missense	probably damaging	1.00
R9776:Ssc5d	UTSW	7	4929368	missense	probably benign	0.07
X0063:Ssc5d	UTSW	7	4936287	missense	probably damaging	1.00
Z1088:Ssc5d	UTSW	7	4928434	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCACACTTAGTATAGATTGCCTTT -3'
(R):5'- TGGTTGGCATCCCAGGGG -3'

Sequencing Primer
(F):5'- TTCAGACCTTCGGAAGAGCAGTC -3'
(R):5'- ATCCCAGGGGGCTGAGTG -3'

Posted On

2021-01-18