Incidental Mutation 'R8480:Ssc5d'
ID 657475
Institutional Source Beutler Lab
Gene Symbol Ssc5d
Ensembl Gene ENSMUSG00000035279
Gene Name scavenger receptor cysteine rich family, 5 domains
Synonyms A430110N23Rik, s5d-srcrb
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 4928820-4947827 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4939328 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 588 (D588V)
Ref Sequence ENSEMBL: ENSMUSP00000052126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057612] [ENSMUST00000208109]
AlphaFold Q8BV57
Predicted Effect probably damaging
Transcript: ENSMUST00000057612
AA Change: D588V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279
AA Change: D588V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SR 20 120 4.44e-49 SMART
low complexity region 141 155 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
SR 199 299 2.36e-53 SMART
SR 305 405 8.22e-53 SMART
low complexity region 437 462 N/A INTRINSIC
SR 464 565 1.11e-49 SMART
low complexity region 741 755 N/A INTRINSIC
SR 758 858 3.93e-50 SMART
low complexity region 936 957 N/A INTRINSIC
low complexity region 981 1004 N/A INTRINSIC
low complexity region 1018 1035 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1357 1364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208109
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b G A 15: 101,108,720 (GRCm39) V499M possibly damaging Het
Adam5 G A 8: 25,294,475 (GRCm39) Q375* probably null Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Aste1 G A 9: 105,274,189 (GRCm39) R143Q possibly damaging Het
Aste1 A T 9: 105,274,995 (GRCm39) T351S probably damaging Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Cdh22 T A 2: 164,988,646 (GRCm39) E236D probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col11a1 A G 3: 113,975,043 (GRCm39) D1234G probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dlec1 G A 9: 118,972,335 (GRCm39) probably null Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm4787 T A 12: 81,424,280 (GRCm39) D626V probably damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Krt36 T C 11: 99,993,635 (GRCm39) D401G possibly damaging Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Lrrc8b A G 5: 105,633,802 (GRCm39) N758S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Or4f14d A T 2: 111,960,330 (GRCm39) D275E possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Recql4 G T 15: 76,588,705 (GRCm39) H1035Q probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sh3d19 T G 3: 85,992,184 (GRCm39) W71G probably benign Het
Sidt1 T C 16: 44,065,529 (GRCm39) Y759C probably damaging Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Szt2 A T 4: 118,244,015 (GRCm39) S1363R probably benign Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zfp473 G T 7: 44,382,323 (GRCm39) P670Q probably damaging Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Ssc5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ssc5d APN 7 4,947,480 (GRCm39) missense possibly damaging 0.63
IGL00939:Ssc5d APN 7 4,939,280 (GRCm39) missense possibly damaging 0.89
IGL01109:Ssc5d APN 7 4,940,111 (GRCm39) nonsense probably null
IGL01409:Ssc5d APN 7 4,945,808 (GRCm39) missense probably benign 0.16
IGL01880:Ssc5d APN 7 4,936,218 (GRCm39) missense probably damaging 1.00
IGL02013:Ssc5d APN 7 4,946,835 (GRCm39) missense probably benign 0.00
IGL02227:Ssc5d APN 7 4,936,453 (GRCm39) critical splice donor site probably null
IGL02963:Ssc5d APN 7 4,947,326 (GRCm39) missense probably benign 0.02
D4043:Ssc5d UTSW 7 4,946,982 (GRCm39) missense possibly damaging 0.70
D4216:Ssc5d UTSW 7 4,946,982 (GRCm39) missense possibly damaging 0.70
R0104:Ssc5d UTSW 7 4,939,285 (GRCm39) missense probably benign 0.41
R0115:Ssc5d UTSW 7 4,930,880 (GRCm39) unclassified probably benign
R0201:Ssc5d UTSW 7 4,947,662 (GRCm39) missense probably benign
R0365:Ssc5d UTSW 7 4,931,466 (GRCm39) nonsense probably null
R0485:Ssc5d UTSW 7 4,940,470 (GRCm39) missense probably damaging 0.99
R0967:Ssc5d UTSW 7 4,947,342 (GRCm39) nonsense probably null
R1607:Ssc5d UTSW 7 4,947,042 (GRCm39) missense probably benign 0.25
R1639:Ssc5d UTSW 7 4,931,416 (GRCm39) missense probably damaging 1.00
R1801:Ssc5d UTSW 7 4,939,606 (GRCm39) missense probably benign 0.05
R1867:Ssc5d UTSW 7 4,931,506 (GRCm39) missense probably damaging 1.00
R1999:Ssc5d UTSW 7 4,945,713 (GRCm39) missense possibly damaging 0.86
R2007:Ssc5d UTSW 7 4,931,628 (GRCm39) missense probably damaging 1.00
R2084:Ssc5d UTSW 7 4,940,011 (GRCm39) missense probably benign 0.01
R2234:Ssc5d UTSW 7 4,946,849 (GRCm39) missense probably benign
R2259:Ssc5d UTSW 7 4,946,915 (GRCm39) missense probably benign 0.01
R2567:Ssc5d UTSW 7 4,939,334 (GRCm39) missense probably damaging 1.00
R2879:Ssc5d UTSW 7 4,939,906 (GRCm39) critical splice acceptor site probably null
R3782:Ssc5d UTSW 7 4,945,790 (GRCm39) missense probably benign 0.00
R3875:Ssc5d UTSW 7 4,930,261 (GRCm39) missense probably damaging 1.00
R4322:Ssc5d UTSW 7 4,931,449 (GRCm39) missense probably damaging 1.00
R4331:Ssc5d UTSW 7 4,945,725 (GRCm39) missense probably benign 0.00
R4334:Ssc5d UTSW 7 4,946,663 (GRCm39) missense probably benign
R4430:Ssc5d UTSW 7 4,946,663 (GRCm39) missense probably benign
R4619:Ssc5d UTSW 7 4,932,524 (GRCm39) missense probably damaging 1.00
R4794:Ssc5d UTSW 7 4,946,744 (GRCm39) missense probably benign
R5106:Ssc5d UTSW 7 4,939,664 (GRCm39) missense probably benign 0.31
R5174:Ssc5d UTSW 7 4,930,970 (GRCm39) missense possibly damaging 0.83
R5553:Ssc5d UTSW 7 4,939,289 (GRCm39) missense probably damaging 1.00
R5649:Ssc5d UTSW 7 4,929,517 (GRCm39) critical splice donor site probably null
R5786:Ssc5d UTSW 7 4,939,817 (GRCm39) missense probably benign 0.00
R6059:Ssc5d UTSW 7 4,945,743 (GRCm39) missense possibly damaging 0.86
R6163:Ssc5d UTSW 7 4,930,253 (GRCm39) missense probably damaging 1.00
R6332:Ssc5d UTSW 7 4,940,521 (GRCm39) missense probably damaging 1.00
R6341:Ssc5d UTSW 7 4,939,664 (GRCm39) missense probably benign 0.31
R6613:Ssc5d UTSW 7 4,936,292 (GRCm39) missense possibly damaging 0.82
R7180:Ssc5d UTSW 7 4,939,600 (GRCm39) missense probably benign 0.17
R7576:Ssc5d UTSW 7 4,931,572 (GRCm39) missense probably damaging 1.00
R7602:Ssc5d UTSW 7 4,945,745 (GRCm39) missense possibly damaging 0.95
R7609:Ssc5d UTSW 7 4,930,575 (GRCm39) missense possibly damaging 0.56
R7691:Ssc5d UTSW 7 4,947,168 (GRCm39) missense probably benign 0.29
R7759:Ssc5d UTSW 7 4,940,529 (GRCm39) nonsense probably null
R9029:Ssc5d UTSW 7 4,930,919 (GRCm39) missense probably damaging 0.97
R9163:Ssc5d UTSW 7 4,936,432 (GRCm39) missense probably damaging 1.00
R9178:Ssc5d UTSW 7 4,930,058 (GRCm39) missense probably damaging 1.00
R9181:Ssc5d UTSW 7 4,945,814 (GRCm39) missense possibly damaging 0.86
R9382:Ssc5d UTSW 7 4,930,283 (GRCm39) critical splice donor site probably null
R9489:Ssc5d UTSW 7 4,940,599 (GRCm39) missense probably benign 0.02
R9626:Ssc5d UTSW 7 4,946,568 (GRCm39) missense probably benign
R9630:Ssc5d UTSW 7 4,939,426 (GRCm39) missense probably damaging 1.00
R9776:Ssc5d UTSW 7 4,932,367 (GRCm39) missense probably benign 0.07
X0063:Ssc5d UTSW 7 4,939,286 (GRCm39) missense probably damaging 1.00
Z1088:Ssc5d UTSW 7 4,931,433 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACACTTAGTATAGATTGCCTTT -3'
(R):5'- TGGTTGGCATCCCAGGGG -3'

Sequencing Primer
(F):5'- TTCAGACCTTCGGAAGAGCAGTC -3'
(R):5'- ATCCCAGGGGGCTGAGTG -3'
Posted On 2021-01-18