Incidental Mutation 'R8480:Zfp473'
ID 657476
Institutional Source Beutler Lab
Gene Symbol Zfp473
Ensembl Gene ENSMUSG00000048012
Gene Name zinc finger protein 473
Synonyms D030014N22Rik
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 44380904-44398041 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 44382323 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 670 (P670Q)
Ref Sequence ENSEMBL: ENSMUSP00000113774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060270] [ENSMUST00000118162] [ENSMUST00000120074] [ENSMUST00000120798] [ENSMUST00000126366] [ENSMUST00000140599] [ENSMUST00000149011]
AlphaFold Q8BI67
Predicted Effect probably damaging
Transcript: ENSMUST00000060270
AA Change: P670Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051069
Gene: ENSMUSG00000048012
AA Change: P670Q

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
ZnF_C2H2 209 231 1.18e-2 SMART
ZnF_C2H2 265 287 8.47e-4 SMART
ZnF_C2H2 377 399 2.4e-3 SMART
ZnF_C2H2 404 426 8.31e0 SMART
ZnF_C2H2 432 454 1.64e-1 SMART
ZnF_C2H2 460 482 1.98e-4 SMART
ZnF_C2H2 488 510 3.44e-4 SMART
ZnF_C2H2 516 538 2.57e-3 SMART
ZnF_C2H2 544 566 3.29e-1 SMART
ZnF_C2H2 572 594 2.29e0 SMART
ZnF_C2H2 697 719 1.47e1 SMART
ZnF_C2H2 725 747 1.04e-3 SMART
ZnF_C2H2 753 775 3.39e-3 SMART
ZnF_C2H2 781 803 2.24e-3 SMART
ZnF_C2H2 809 831 5.99e-4 SMART
ZnF_C2H2 837 859 1.36e-2 SMART
ZnF_C2H2 865 887 2.57e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118162
AA Change: P669Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113316
Gene: ENSMUSG00000048012
AA Change: P669Q

DomainStartEndE-ValueType
KRAB 23 83 7.75e-3 SMART
ZnF_C2H2 208 230 1.18e-2 SMART
ZnF_C2H2 264 286 8.47e-4 SMART
ZnF_C2H2 376 398 2.4e-3 SMART
ZnF_C2H2 403 425 8.31e0 SMART
ZnF_C2H2 431 453 1.64e-1 SMART
ZnF_C2H2 459 481 1.98e-4 SMART
ZnF_C2H2 487 509 3.44e-4 SMART
ZnF_C2H2 515 537 2.57e-3 SMART
ZnF_C2H2 543 565 3.29e-1 SMART
ZnF_C2H2 571 593 2.29e0 SMART
ZnF_C2H2 696 718 1.47e1 SMART
ZnF_C2H2 724 746 1.04e-3 SMART
ZnF_C2H2 752 774 3.39e-3 SMART
ZnF_C2H2 780 802 2.24e-3 SMART
ZnF_C2H2 808 830 5.99e-4 SMART
ZnF_C2H2 836 858 1.36e-2 SMART
ZnF_C2H2 864 886 2.57e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120074
AA Change: P670Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113774
Gene: ENSMUSG00000048012
AA Change: P670Q

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
ZnF_C2H2 209 231 1.18e-2 SMART
ZnF_C2H2 265 287 8.47e-4 SMART
ZnF_C2H2 377 399 2.4e-3 SMART
ZnF_C2H2 404 426 8.31e0 SMART
ZnF_C2H2 432 454 1.64e-1 SMART
ZnF_C2H2 460 482 1.98e-4 SMART
ZnF_C2H2 488 510 3.44e-4 SMART
ZnF_C2H2 516 538 2.57e-3 SMART
ZnF_C2H2 544 566 3.29e-1 SMART
ZnF_C2H2 572 594 2.29e0 SMART
ZnF_C2H2 697 719 1.47e1 SMART
ZnF_C2H2 725 747 1.04e-3 SMART
ZnF_C2H2 753 775 3.39e-3 SMART
ZnF_C2H2 781 803 2.24e-3 SMART
ZnF_C2H2 809 831 5.99e-4 SMART
ZnF_C2H2 837 859 1.36e-2 SMART
ZnF_C2H2 865 887 2.57e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120798
AA Change: P669Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113789
Gene: ENSMUSG00000048012
AA Change: P669Q

DomainStartEndE-ValueType
KRAB 23 83 7.75e-3 SMART
ZnF_C2H2 208 230 1.18e-2 SMART
ZnF_C2H2 264 286 8.47e-4 SMART
ZnF_C2H2 376 398 2.4e-3 SMART
ZnF_C2H2 403 425 8.31e0 SMART
ZnF_C2H2 431 453 1.64e-1 SMART
ZnF_C2H2 459 481 1.98e-4 SMART
ZnF_C2H2 487 509 3.44e-4 SMART
ZnF_C2H2 515 537 2.57e-3 SMART
ZnF_C2H2 543 565 3.29e-1 SMART
ZnF_C2H2 571 593 2.29e0 SMART
ZnF_C2H2 696 718 1.47e1 SMART
ZnF_C2H2 724 746 1.04e-3 SMART
ZnF_C2H2 752 774 3.39e-3 SMART
ZnF_C2H2 780 802 2.24e-3 SMART
ZnF_C2H2 808 830 5.99e-4 SMART
ZnF_C2H2 836 858 1.36e-2 SMART
ZnF_C2H2 864 886 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126366
SMART Domains Protein: ENSMUSP00000127101
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140599
SMART Domains Protein: ENSMUSP00000127738
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149011
SMART Domains Protein: ENSMUSP00000130689
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Krueppel C2H2-type zinc-finger family of proteins. The encoded protein, a component of the U7 snRNP complex, plays a role in histone 3'-end pre-mRNA processing and may be required for cell cycle progression to S phase. Expression level and methylation status of this gene may be correlated with bone mineral density. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b G A 15: 101,108,720 (GRCm39) V499M possibly damaging Het
Adam5 G A 8: 25,294,475 (GRCm39) Q375* probably null Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Aste1 G A 9: 105,274,189 (GRCm39) R143Q possibly damaging Het
Aste1 A T 9: 105,274,995 (GRCm39) T351S probably damaging Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Cdh22 T A 2: 164,988,646 (GRCm39) E236D probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col11a1 A G 3: 113,975,043 (GRCm39) D1234G probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dlec1 G A 9: 118,972,335 (GRCm39) probably null Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm4787 T A 12: 81,424,280 (GRCm39) D626V probably damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Krt36 T C 11: 99,993,635 (GRCm39) D401G possibly damaging Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Lrrc8b A G 5: 105,633,802 (GRCm39) N758S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Or4f14d A T 2: 111,960,330 (GRCm39) D275E possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Recql4 G T 15: 76,588,705 (GRCm39) H1035Q probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sh3d19 T G 3: 85,992,184 (GRCm39) W71G probably benign Het
Sidt1 T C 16: 44,065,529 (GRCm39) Y759C probably damaging Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Ssc5d A T 7: 4,939,328 (GRCm39) D588V probably damaging Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Szt2 A T 4: 118,244,015 (GRCm39) S1363R probably benign Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Zfp473
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Zfp473 APN 7 44,383,992 (GRCm39) missense probably damaging 1.00
IGL01443:Zfp473 APN 7 44,388,987 (GRCm39) missense probably damaging 0.99
IGL01459:Zfp473 APN 7 44,388,987 (GRCm39) missense probably damaging 0.99
IGL01905:Zfp473 APN 7 44,383,151 (GRCm39) missense probably benign 0.00
IGL02027:Zfp473 APN 7 44,387,462 (GRCm39) splice site probably benign
IGL02314:Zfp473 APN 7 44,383,353 (GRCm39) missense probably benign 0.00
IGL02445:Zfp473 APN 7 44,383,107 (GRCm39) missense probably damaging 1.00
IGL03033:Zfp473 APN 7 44,382,522 (GRCm39) missense probably benign 0.05
R0037:Zfp473 UTSW 7 44,383,324 (GRCm39) missense probably damaging 0.96
R0054:Zfp473 UTSW 7 44,383,899 (GRCm39) missense probably damaging 0.99
R0054:Zfp473 UTSW 7 44,383,899 (GRCm39) missense probably damaging 0.99
R0190:Zfp473 UTSW 7 44,382,612 (GRCm39) missense probably damaging 1.00
R1178:Zfp473 UTSW 7 44,384,018 (GRCm39) missense probably benign 0.00
R1387:Zfp473 UTSW 7 44,382,365 (GRCm39) missense probably benign 0.00
R2141:Zfp473 UTSW 7 44,382,501 (GRCm39) missense possibly damaging 0.57
R2142:Zfp473 UTSW 7 44,382,501 (GRCm39) missense possibly damaging 0.57
R4194:Zfp473 UTSW 7 44,381,676 (GRCm39) missense probably benign 0.08
R4453:Zfp473 UTSW 7 44,382,678 (GRCm39) missense probably damaging 0.99
R4585:Zfp473 UTSW 7 44,382,376 (GRCm39) nonsense probably null
R4586:Zfp473 UTSW 7 44,382,376 (GRCm39) nonsense probably null
R4945:Zfp473 UTSW 7 44,383,988 (GRCm39) missense probably benign 0.00
R5072:Zfp473 UTSW 7 44,381,943 (GRCm39) missense probably damaging 0.98
R5429:Zfp473 UTSW 7 44,382,272 (GRCm39) missense possibly damaging 0.69
R5464:Zfp473 UTSW 7 44,382,062 (GRCm39) missense probably damaging 1.00
R5551:Zfp473 UTSW 7 44,383,575 (GRCm39) missense probably benign 0.03
R5618:Zfp473 UTSW 7 44,391,156 (GRCm39) missense probably benign 0.08
R5985:Zfp473 UTSW 7 44,382,752 (GRCm39) missense probably damaging 1.00
R6288:Zfp473 UTSW 7 44,382,958 (GRCm39) missense probably damaging 1.00
R6701:Zfp473 UTSW 7 44,382,218 (GRCm39) missense possibly damaging 0.58
R7069:Zfp473 UTSW 7 44,381,798 (GRCm39) missense probably damaging 1.00
R7284:Zfp473 UTSW 7 44,382,627 (GRCm39) missense not run
R7361:Zfp473 UTSW 7 44,382,563 (GRCm39) missense probably damaging 1.00
R7495:Zfp473 UTSW 7 44,387,368 (GRCm39) missense probably benign 0.04
R7631:Zfp473 UTSW 7 44,383,128 (GRCm39) missense possibly damaging 0.62
R7940:Zfp473 UTSW 7 44,384,000 (GRCm39) missense probably damaging 1.00
R7957:Zfp473 UTSW 7 44,381,916 (GRCm39) missense probably damaging 1.00
R9464:Zfp473 UTSW 7 44,383,766 (GRCm39) missense probably benign 0.00
R9569:Zfp473 UTSW 7 44,388,971 (GRCm39) missense probably damaging 1.00
X0027:Zfp473 UTSW 7 44,382,842 (GRCm39) missense probably damaging 1.00
Z1177:Zfp473 UTSW 7 44,381,732 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATGATCGCTGATGAAATG -3'
(R):5'- AGAAAGTTGTGGGTCAGAACTC -3'

Sequencing Primer
(F):5'- TGAAGGCTCTGTCACATTCG -3'
(R):5'- TGGGTCAGAACTCACAGCAC -3'
Posted On 2021-01-18