Incidental Mutation 'R8480:Adam5'
ID 657478
Institutional Source Beutler Lab
Gene Symbol Adam5
Ensembl Gene ENSMUSG00000031554
Gene Name a disintegrin and metallopeptidase domain 5
Synonyms tMDCII
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 25217109-25314385 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 25294475 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 375 (Q375*)
Ref Sequence ENSEMBL: ENSMUSP00000147290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050300] [ENSMUST00000118419] [ENSMUST00000209935]
AlphaFold Q3TTE0
Predicted Effect probably null
Transcript: ENSMUST00000050300
AA Change: Q375*
SMART Domains Protein: ENSMUSP00000052661
Gene: ENSMUSG00000031554
AA Change: Q375*

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 1.6e-19 PFAM
Pfam:Reprolysin 185 378 7.7e-59 PFAM
DISIN 397 474 9.1e-42 SMART
ACR 475 618 6.9e-58 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 751 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118419
AA Change: Q375*
SMART Domains Protein: ENSMUSP00000112422
Gene: ENSMUSG00000031554
AA Change: Q375*

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 4.7e-30 PFAM
Pfam:Reprolysin 185 378 7.9e-56 PFAM
DISIN 397 474 1.78e-39 SMART
ACR 475 618 2.06e-55 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 750 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132180
AA Change: Q292*
SMART Domains Protein: ENSMUSP00000121272
Gene: ENSMUSG00000031554
AA Change: Q292*

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 1 60 6.7e-14 PFAM
Pfam:Reprolysin 103 296 2.5e-61 PFAM
DISIN 315 392 1.78e-39 SMART
ACR 393 536 2.06e-55 SMART
Predicted Effect probably null
Transcript: ENSMUST00000209935
AA Change: Q375*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b G A 15: 101,108,720 (GRCm39) V499M possibly damaging Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Aste1 G A 9: 105,274,189 (GRCm39) R143Q possibly damaging Het
Aste1 A T 9: 105,274,995 (GRCm39) T351S probably damaging Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Cdh22 T A 2: 164,988,646 (GRCm39) E236D probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col11a1 A G 3: 113,975,043 (GRCm39) D1234G probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dlec1 G A 9: 118,972,335 (GRCm39) probably null Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm4787 T A 12: 81,424,280 (GRCm39) D626V probably damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Krt36 T C 11: 99,993,635 (GRCm39) D401G possibly damaging Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Lrrc8b A G 5: 105,633,802 (GRCm39) N758S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Or4f14d A T 2: 111,960,330 (GRCm39) D275E possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Recql4 G T 15: 76,588,705 (GRCm39) H1035Q probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sh3d19 T G 3: 85,992,184 (GRCm39) W71G probably benign Het
Sidt1 T C 16: 44,065,529 (GRCm39) Y759C probably damaging Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Ssc5d A T 7: 4,939,328 (GRCm39) D588V probably damaging Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Szt2 A T 4: 118,244,015 (GRCm39) S1363R probably benign Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zfp473 G T 7: 44,382,323 (GRCm39) P670Q probably damaging Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Adam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Adam5 APN 8 25,308,758 (GRCm39) missense probably benign 0.18
IGL01285:Adam5 APN 8 25,271,610 (GRCm39) missense probably benign 0.02
IGL01310:Adam5 APN 8 25,232,150 (GRCm39) intron probably benign
IGL01510:Adam5 APN 8 25,294,481 (GRCm39) missense probably damaging 1.00
IGL01570:Adam5 APN 8 25,300,839 (GRCm39) missense probably damaging 1.00
IGL02017:Adam5 APN 8 25,271,775 (GRCm39) missense probably benign 0.38
IGL02191:Adam5 APN 8 25,302,439 (GRCm39) nonsense probably null
IGL02397:Adam5 APN 8 25,234,149 (GRCm39) intron probably benign
IGL02488:Adam5 APN 8 25,282,022 (GRCm39) missense probably damaging 0.98
IGL02490:Adam5 APN 8 25,271,720 (GRCm39) nonsense probably null
IGL02499:Adam5 APN 8 25,271,581 (GRCm39) critical splice donor site probably null
IGL02539:Adam5 APN 8 25,276,229 (GRCm39) nonsense probably null
IGL02590:Adam5 APN 8 25,234,151 (GRCm39) intron probably benign
IGL02677:Adam5 APN 8 25,302,395 (GRCm39) splice site probably benign
IGL02679:Adam5 APN 8 25,296,542 (GRCm39) missense probably damaging 1.00
IGL02982:Adam5 APN 8 25,294,447 (GRCm39) missense probably benign 0.02
IGL03146:Adam5 APN 8 25,294,519 (GRCm39) missense probably damaging 0.98
IGL03162:Adam5 APN 8 25,271,620 (GRCm39) missense probably benign 0.30
IGL03284:Adam5 APN 8 25,276,354 (GRCm39) splice site probably benign
R0081:Adam5 UTSW 8 25,271,703 (GRCm39) missense probably damaging 1.00
R0377:Adam5 UTSW 8 25,237,557 (GRCm39) missense probably benign 0.08
R0398:Adam5 UTSW 8 25,303,448 (GRCm39) missense probably benign 0.17
R0771:Adam5 UTSW 8 25,276,315 (GRCm39) missense probably benign 0.04
R0925:Adam5 UTSW 8 25,302,441 (GRCm39) missense probably benign 0.09
R1547:Adam5 UTSW 8 25,300,729 (GRCm39) missense probably benign 0.10
R1985:Adam5 UTSW 8 25,236,755 (GRCm39) missense probably benign 0.01
R2115:Adam5 UTSW 8 25,234,161 (GRCm39) intron probably benign
R2125:Adam5 UTSW 8 25,305,134 (GRCm39) missense probably damaging 1.00
R2144:Adam5 UTSW 8 25,305,496 (GRCm39) missense probably benign 0.14
R3151:Adam5 UTSW 8 25,271,647 (GRCm39) missense probably damaging 0.99
R3612:Adam5 UTSW 8 25,308,105 (GRCm39) splice site probably benign
R3844:Adam5 UTSW 8 25,303,426 (GRCm39) missense probably benign 0.12
R3873:Adam5 UTSW 8 25,305,125 (GRCm39) missense probably benign 0.02
R4514:Adam5 UTSW 8 25,308,152 (GRCm39) missense probably damaging 1.00
R4843:Adam5 UTSW 8 25,303,552 (GRCm39) missense probably damaging 1.00
R4866:Adam5 UTSW 8 25,232,172 (GRCm39) splice site probably null
R4866:Adam5 UTSW 8 25,271,619 (GRCm39) missense probably damaging 0.98
R4900:Adam5 UTSW 8 25,271,619 (GRCm39) missense probably damaging 0.98
R4900:Adam5 UTSW 8 25,232,172 (GRCm39) splice site probably null
R4903:Adam5 UTSW 8 25,276,248 (GRCm39) missense probably damaging 1.00
R4936:Adam5 UTSW 8 25,276,287 (GRCm39) missense probably damaging 1.00
R4964:Adam5 UTSW 8 25,276,248 (GRCm39) missense probably damaging 1.00
R5259:Adam5 UTSW 8 25,300,850 (GRCm39) missense possibly damaging 0.90
R5293:Adam5 UTSW 8 25,300,722 (GRCm39) missense possibly damaging 0.46
R5724:Adam5 UTSW 8 25,294,511 (GRCm39) nonsense probably null
R5859:Adam5 UTSW 8 25,303,477 (GRCm39) missense probably benign
R6004:Adam5 UTSW 8 25,271,685 (GRCm39) missense probably benign 0.04
R6175:Adam5 UTSW 8 25,276,167 (GRCm39) missense probably benign 0.00
R6539:Adam5 UTSW 8 25,272,616 (GRCm39) missense possibly damaging 0.85
R6994:Adam5 UTSW 8 25,276,262 (GRCm39) nonsense probably null
R6996:Adam5 UTSW 8 25,296,517 (GRCm39) missense probably damaging 1.00
R7009:Adam5 UTSW 8 25,296,454 (GRCm39) missense probably benign 0.00
R7115:Adam5 UTSW 8 25,271,712 (GRCm39) missense possibly damaging 0.69
R7127:Adam5 UTSW 8 25,300,797 (GRCm39) missense probably damaging 1.00
R7469:Adam5 UTSW 8 25,305,541 (GRCm39) missense probably benign 0.45
R7780:Adam5 UTSW 8 25,294,432 (GRCm39) missense possibly damaging 0.49
R8027:Adam5 UTSW 8 25,272,574 (GRCm39) missense probably damaging 1.00
R8069:Adam5 UTSW 8 25,303,541 (GRCm39) missense probably damaging 1.00
R8138:Adam5 UTSW 8 25,271,778 (GRCm39) missense probably damaging 1.00
R8305:Adam5 UTSW 8 25,300,719 (GRCm39) missense possibly damaging 0.93
R8359:Adam5 UTSW 8 25,296,502 (GRCm39) missense probably damaging 1.00
R8743:Adam5 UTSW 8 25,276,264 (GRCm39) missense probably damaging 1.00
R9000:Adam5 UTSW 8 25,294,372 (GRCm39) critical splice donor site probably null
R9442:Adam5 UTSW 8 25,296,510 (GRCm39) missense probably damaging 0.96
R9474:Adam5 UTSW 8 25,237,540 (GRCm39) missense possibly damaging 0.95
R9602:Adam5 UTSW 8 25,303,402 (GRCm39) missense probably damaging 0.96
R9748:Adam5 UTSW 8 25,301,068 (GRCm39) missense probably benign 0.23
X0019:Adam5 UTSW 8 25,302,459 (GRCm39) missense probably benign 0.00
X0022:Adam5 UTSW 8 25,303,579 (GRCm39) critical splice acceptor site probably null
X0027:Adam5 UTSW 8 25,308,788 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTTCTTAGCACTGCACATA -3'
(R):5'- CATAGCAATCTCATGGCTGTGTTT -3'

Sequencing Primer
(F):5'- TAGCACTGCACATAAAAACTGAAGTG -3'
(R):5'- AAGGATGGTGCTCTCAAAATCC -3'
Posted On 2021-01-18