Incidental Mutation 'R8480:Aste1'
ID 657483
Institutional Source Beutler Lab
Gene Symbol Aste1
Ensembl Gene ENSMUSG00000032567
Gene Name asteroid homolog 1
Synonyms 1100001A21Rik
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 105272533-105285497 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105274995 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 351 (T351S)
Ref Sequence ENSEMBL: ENSMUSP00000149596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035181] [ENSMUST00000038648] [ENSMUST00000123807] [ENSMUST00000140851] [ENSMUST00000156256] [ENSMUST00000167674] [ENSMUST00000176350] [ENSMUST00000176940] [ENSMUST00000177029] [ENSMUST00000177402] [ENSMUST00000189758]
AlphaFold Q8BIR2
Predicted Effect possibly damaging
Transcript: ENSMUST00000035181
AA Change: T412S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035181
Gene: ENSMUSG00000032567
AA Change: T412S

DomainStartEndE-ValueType
Pfam:XPG_I_2 115 307 1e-18 PFAM
low complexity region 476 488 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038648
SMART Domains Protein: ENSMUSP00000038611
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
S_TKc 30 288 3.87e-80 SMART
coiled coil region 348 384 N/A INTRINSIC
low complexity region 408 423 N/A INTRINSIC
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123807
AA Change: T351S

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000123807
AA Change: T351S

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000140851
SMART Domains Protein: ENSMUSP00000116864
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
S_TKc 30 288 3.87e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156256
SMART Domains Protein: ENSMUSP00000116761
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
Pfam:Pkinase 30 177 8.9e-36 PFAM
Pfam:Pkinase_Tyr 30 178 8.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167674
SMART Domains Protein: ENSMUSP00000131164
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176350
Predicted Effect probably benign
Transcript: ENSMUST00000176940
Predicted Effect probably benign
Transcript: ENSMUST00000177029
SMART Domains Protein: ENSMUSP00000135837
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
SCOP:d1h8fa_ 11 80 1e-6 SMART
Blast:S_TKc 30 70 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177402
SMART Domains Protein: ENSMUSP00000135318
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189758
SMART Domains Protein: ENSMUSP00000139854
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
Allele List at MGI

All alleles(6) : Targeted(4) Gene trapped(2)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b G A 15: 101,108,720 (GRCm39) V499M possibly damaging Het
Adam5 G A 8: 25,294,475 (GRCm39) Q375* probably null Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Cdh22 T A 2: 164,988,646 (GRCm39) E236D probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col11a1 A G 3: 113,975,043 (GRCm39) D1234G probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dlec1 G A 9: 118,972,335 (GRCm39) probably null Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm4787 T A 12: 81,424,280 (GRCm39) D626V probably damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Krt36 T C 11: 99,993,635 (GRCm39) D401G possibly damaging Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Lrrc8b A G 5: 105,633,802 (GRCm39) N758S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Or4f14d A T 2: 111,960,330 (GRCm39) D275E possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Recql4 G T 15: 76,588,705 (GRCm39) H1035Q probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sh3d19 T G 3: 85,992,184 (GRCm39) W71G probably benign Het
Sidt1 T C 16: 44,065,529 (GRCm39) Y759C probably damaging Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Ssc5d A T 7: 4,939,328 (GRCm39) D588V probably damaging Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Szt2 A T 4: 118,244,015 (GRCm39) S1363R probably benign Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zfp473 G T 7: 44,382,323 (GRCm39) P670Q probably damaging Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Aste1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Aste1 APN 9 105,275,043 (GRCm39) missense probably damaging 0.99
IGL03161:Aste1 APN 9 105,273,871 (GRCm39) missense probably damaging 1.00
R0022:Aste1 UTSW 9 105,273,823 (GRCm39) nonsense probably null
R0022:Aste1 UTSW 9 105,273,823 (GRCm39) nonsense probably null
R1485:Aste1 UTSW 9 105,275,009 (GRCm39) nonsense probably null
R2010:Aste1 UTSW 9 105,280,701 (GRCm39) missense probably damaging 1.00
R5048:Aste1 UTSW 9 105,274,188 (GRCm39) missense probably damaging 1.00
R5084:Aste1 UTSW 9 105,274,886 (GRCm39) nonsense probably null
R5091:Aste1 UTSW 9 105,282,203 (GRCm39) missense probably damaging 1.00
R5197:Aste1 UTSW 9 105,282,253 (GRCm39) missense probably damaging 1.00
R5294:Aste1 UTSW 9 105,279,904 (GRCm39) splice site probably null
R5617:Aste1 UTSW 9 105,275,034 (GRCm39) missense probably benign 0.00
R5834:Aste1 UTSW 9 105,280,614 (GRCm39) missense probably benign 0.01
R6214:Aste1 UTSW 9 105,274,056 (GRCm39) missense probably damaging 0.96
R6215:Aste1 UTSW 9 105,274,056 (GRCm39) missense probably damaging 0.96
R6249:Aste1 UTSW 9 105,273,816 (GRCm39) missense probably benign 0.00
R6913:Aste1 UTSW 9 105,274,607 (GRCm39) missense probably benign 0.01
R7069:Aste1 UTSW 9 105,273,906 (GRCm39) critical splice donor site probably null
R7155:Aste1 UTSW 9 105,282,335 (GRCm39) missense probably damaging 1.00
R7360:Aste1 UTSW 9 105,274,835 (GRCm39) missense probably damaging 0.97
R7488:Aste1 UTSW 9 105,279,904 (GRCm39) splice site probably null
R7588:Aste1 UTSW 9 105,274,590 (GRCm39) missense possibly damaging 0.73
R7734:Aste1 UTSW 9 105,274,678 (GRCm39) missense probably damaging 0.99
R8358:Aste1 UTSW 9 105,274,255 (GRCm39) missense probably damaging 1.00
R8480:Aste1 UTSW 9 105,274,189 (GRCm39) missense possibly damaging 0.92
R8481:Aste1 UTSW 9 105,274,189 (GRCm39) missense possibly damaging 0.92
R8767:Aste1 UTSW 9 105,274,098 (GRCm39) missense possibly damaging 0.56
R8915:Aste1 UTSW 9 105,273,880 (GRCm39) missense probably benign 0.00
R8945:Aste1 UTSW 9 105,273,880 (GRCm39) missense probably benign 0.00
R9128:Aste1 UTSW 9 105,273,908 (GRCm39) nonsense probably null
R9213:Aste1 UTSW 9 105,274,294 (GRCm39) missense probably damaging 1.00
R9375:Aste1 UTSW 9 105,273,880 (GRCm39) missense probably benign 0.00
R9377:Aste1 UTSW 9 105,273,880 (GRCm39) missense probably benign 0.00
R9501:Aste1 UTSW 9 105,273,880 (GRCm39) missense probably benign 0.00
R9502:Aste1 UTSW 9 105,273,880 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATCAGTGATGCTTTGGTGCTC -3'
(R):5'- AGTTCACTGGAGGTCTAGCC -3'

Sequencing Primer
(F):5'- GGACCTTTCTTCACACACAGGTAG -3'
(R):5'- GGTCTAGCCTTCACACACAACATG -3'
Posted On 2021-01-18