Incidental Mutation 'R8480:Sppl2b'
ID 657484
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Name signal peptide peptidase like 2B
Synonyms 3110056O03Rik
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R8480 (G1)
Quality Score 217.468
Status Not validated
Chromosome 10
Chromosomal Location 80691109-80704542 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TGTCACAGGT to TGT at 80701903 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
AlphaFold Q3TD49
Predicted Effect probably null
Transcript: ENSMUST00000035597
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218789
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Predicted Effect probably null
Transcript: ENSMUST00000219951
Predicted Effect probably null
Transcript: ENSMUST00000220091
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b G A 15: 101,108,720 (GRCm39) V499M possibly damaging Het
Adam5 G A 8: 25,294,475 (GRCm39) Q375* probably null Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Aste1 G A 9: 105,274,189 (GRCm39) R143Q possibly damaging Het
Aste1 A T 9: 105,274,995 (GRCm39) T351S probably damaging Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Cdh22 T A 2: 164,988,646 (GRCm39) E236D probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col11a1 A G 3: 113,975,043 (GRCm39) D1234G probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dlec1 G A 9: 118,972,335 (GRCm39) probably null Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm4787 T A 12: 81,424,280 (GRCm39) D626V probably damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Krt36 T C 11: 99,993,635 (GRCm39) D401G possibly damaging Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Lrrc8b A G 5: 105,633,802 (GRCm39) N758S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Or4f14d A T 2: 111,960,330 (GRCm39) D275E possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Recql4 G T 15: 76,588,705 (GRCm39) H1035Q probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sh3d19 T G 3: 85,992,184 (GRCm39) W71G probably benign Het
Sidt1 T C 16: 44,065,529 (GRCm39) Y759C probably damaging Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Ssc5d A T 7: 4,939,328 (GRCm39) D588V probably damaging Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Szt2 A T 4: 118,244,015 (GRCm39) S1363R probably benign Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zfp473 G T 7: 44,382,323 (GRCm39) P670Q probably damaging Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80,699,928 (GRCm39) missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80,701,175 (GRCm39) missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80,697,220 (GRCm39) missense probably benign 0.00
IGL01964:Sppl2b APN 10 80,701,220 (GRCm39) critical splice donor site probably null
IGL02376:Sppl2b APN 10 80,703,432 (GRCm39) nonsense probably null
R1641:Sppl2b UTSW 10 80,700,965 (GRCm39) missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80,701,451 (GRCm39) missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R3106:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R4350:Sppl2b UTSW 10 80,698,560 (GRCm39) missense probably benign 0.12
R5146:Sppl2b UTSW 10 80,703,474 (GRCm39) makesense probably null
R5698:Sppl2b UTSW 10 80,701,879 (GRCm39) splice site probably null
R6969:Sppl2b UTSW 10 80,700,959 (GRCm39) missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80,703,253 (GRCm39) missense probably benign 0.02
R8212:Sppl2b UTSW 10 80,701,193 (GRCm39) missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8265:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8367:Sppl2b UTSW 10 80,699,025 (GRCm39) missense probably benign 0.02
R8398:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8398:Sppl2b UTSW 10 80,701,902 (GRCm39) frame shift probably null
R8400:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8481:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8505:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8817:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8818:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8832:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R9175:Sppl2b UTSW 10 80,698,807 (GRCm39) missense probably benign
R9624:Sppl2b UTSW 10 80,699,373 (GRCm39) missense probably benign 0.03
Z1176:Sppl2b UTSW 10 80,703,259 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TGTGCATGCCCATTGTCACC -3'
(R):5'- TGGGCCAGACACTCAACTACTC -3'

Sequencing Primer
(F):5'- ATTGTCACCATCCACCTGGCAG -3'
(R):5'- AAGCCCAGCCCCACTAGG -3'
Posted On 2021-01-18