Mutagenetix > Incidental Mutation

Incidental Mutation 'R8480:Sppl2b'

657484

Institutional Source

Beutler Lab

Gene Symbol

Sppl2b

Ensembl Gene

ENSMUSG00000035206

Gene Name

signal peptide peptidase like 2B

Synonyms

3110056O03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.869) question?

Stock #

R8480 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

80855275-80868708 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

TGTCACAGGT to TGT at 80866069 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000036289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]

AlphaFold

Q3TD49

Predicted Effect

probably null
Transcript: ENSMUST00000035597

SMART Domains

Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	25	36	N/A	INTRINSIC
Pfam:PA	55	147	5.5e-14	PFAM
transmembrane domain	167	189	N/A	INTRINSIC
PSN	210	485	2.16e-113	SMART
low complexity region	520	531	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000218789

Predicted Effect

probably benign
Transcript: ENSMUST00000219614

Predicted Effect

probably null
Transcript: ENSMUST00000219951

Predicted Effect

probably null
Transcript: ENSMUST00000220091

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,187,458	P720Q	possibly damaging	Het
Acvr1b	G	A	15: 101,210,839	V499M	possibly damaging	Het
Adam5	G	A	8: 24,804,459	Q375*	probably null	Het
Adgrf1	G	A	17: 43,295,164	E60K	probably benign	Het
Alb	T	C	5: 90,462,771	V70A	probably damaging	Het
Aph1b	T	A	9: 66,788,427		probably benign	Het
Aste1	G	A	9: 105,396,990	R143Q	possibly damaging	Het
Aste1	A	T	9: 105,397,796	T351S	probably damaging	Het
Bace2	T	A	16: 97,413,470	L286Q	probably damaging	Het
Bach1	G	A	16: 87,719,275	G235R	probably damaging	Het
Brwd1	A	T	16: 96,047,430	H516Q	probably damaging	Het
Cc2d2a	C	A	5: 43,685,144		probably null	Het
Cdh22	T	A	2: 165,146,726	E236D	probably benign	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Celsr2	T	A	3: 108,398,902	T2029S	probably benign	Het
Col11a1	A	G	3: 114,181,394	D1234G	probably benign	Het
Cpt2	A	G	4: 107,907,760	I269T	probably damaging	Het
Dcaf7	T	A	11: 106,054,793	S323T	probably benign	Het
Ddias	G	T	7: 92,859,400	Q436K	probably benign	Het
Dlec1	G	A	9: 119,143,267		probably null	Het
Dock5	T	A	14: 67,836,410	I294F	probably benign	Het
Fat2	A	T	11: 55,282,968	D2306E	possibly damaging	Het
Gm4787	T	A	12: 81,377,506	D626V	probably damaging	Het
Gm6563	A	G	19: 23,675,926	T27A	probably benign	Het
Hadhb	T	C	5: 30,168,570		probably null	Het
Hsph1	A	T	5: 149,627,564	W406R	probably null	Het
Ighv1-66	C	T	12: 115,593,382	G27R	possibly damaging	Het
Impad1	C	T	4: 4,769,376	M246I	probably benign	Het
Krt26	T	C	11: 99,337,600	E102G	probably damaging	Het
Krt34	T	A	11: 100,040,145		probably null	Het
Krt36	T	C	11: 100,102,809	D401G	possibly damaging	Het
Loxhd1	G	A	18: 77,431,131	G326S	probably damaging	Het
Lrrc8b	A	G	5: 105,485,936	N758S	probably damaging	Het
Mkl2	A	T	16: 13,384,192		probably null	Het
Muc4	C	T	16: 32,752,993	T957I	probably benign	Het
Naip5	T	C	13: 100,222,235	Y831C	probably damaging	Het
Nfatc1	A	T	18: 80,635,644	V829E	probably benign	Het
Nmnat1	G	A	4: 149,473,370	L72F	possibly damaging	Het
Olfr1316	A	T	2: 112,129,985	D275E	possibly damaging	Het
Pcdh7	T	A	5: 58,129,065	V1161E	probably damaging	Het
Raver1	A	G	9: 21,090,280	Y86H	probably benign	Het
Recql4	G	T	15: 76,704,505	H1035Q	probably benign	Het
Sgsm1	A	T	5: 113,263,418	M814K	probably benign	Het
Sh3d19	T	G	3: 86,084,877	W71G	probably benign	Het
Sidt1	T	C	16: 44,245,166	Y759C	probably damaging	Het
Spg11	G	T	2: 122,113,079	D197E	probably damaging	Het
Ssc5d	A	T	7: 4,936,329	D588V	probably damaging	Het
Supt20	C	A	3: 54,707,116	T181K	probably damaging	Het
Szt2	A	T	4: 118,386,818	S1363R	probably benign	Het
Tbcel	G	A	9: 42,463,873		probably null	Het
Ube2e3	T	C	2: 78,918,814	L169P	probably damaging	Het
Wrn	A	G	8: 33,288,768	F595S	probably benign	Het
Zfp473	G	T	7: 44,732,899	P670Q	probably damaging	Het
Zw10	C	T	9: 49,074,999	A660V	probably benign	Het

Other mutations in Sppl2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Sppl2b	APN	10	80864094	missense	probably damaging	1.00
IGL01835:Sppl2b	APN	10	80865341	missense	probably damaging	0.99
IGL01836:Sppl2b	APN	10	80861386	missense	probably benign	0.00
IGL01964:Sppl2b	APN	10	80865386	critical splice donor site	probably null
IGL02376:Sppl2b	APN	10	80867598	nonsense	probably null
R1641:Sppl2b	UTSW	10	80865131	missense	probably damaging	0.96
R2228:Sppl2b	UTSW	10	80865617	missense	probably damaging	1.00
R3104:Sppl2b	UTSW	10	80867491	missense	probably benign	0.00
R3106:Sppl2b	UTSW	10	80867491	missense	probably benign	0.00
R4350:Sppl2b	UTSW	10	80862726	missense	probably benign	0.12
R5146:Sppl2b	UTSW	10	80867640	makesense	probably null
R5698:Sppl2b	UTSW	10	80866045	splice site	probably null
R6969:Sppl2b	UTSW	10	80865125	missense	probably damaging	1.00
R7649:Sppl2b	UTSW	10	80867419	missense	probably benign	0.02
R8212:Sppl2b	UTSW	10	80865359	missense	probably damaging	1.00
R8263:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8265:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8367:Sppl2b	UTSW	10	80863191	missense	probably benign	0.02
R8398:Sppl2b	UTSW	10	80866068	frame shift	probably null
R8398:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8400:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8481:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8505:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8817:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8818:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8832:Sppl2b	UTSW	10	80866069	frame shift	probably null
R9175:Sppl2b	UTSW	10	80862973	missense	probably benign
R9624:Sppl2b	UTSW	10	80863539	missense	probably benign	0.03
Z1176:Sppl2b	UTSW	10	80867425	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- TGTGCATGCCCATTGTCACC -3'
(R):5'- TGGGCCAGACACTCAACTACTC -3'

Sequencing Primer
(F):5'- ATTGTCACCATCCACCTGGCAG -3'
(R):5'- AAGCCCAGCCCCACTAGG -3'

Posted On

2021-01-18