Mutagenetix > Incidental Mutation

Incidental Mutation 'R8480:Krt36'

657488

Institutional Source

Beutler Lab

Gene Symbol

Krt36

Ensembl Gene

ENSMUSG00000020916

Gene Name

keratin 36

Synonyms

Krt1-22, keratin 5, HRa-1, Krt1-5

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R8480 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100102007-100105626 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100102809 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 401 (D401G)

Ref Sequence

ENSEMBL: ENSMUSP00000103039 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107416]

AlphaFold

B1AQ75

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107416
AA Change: D401G

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000103039
Gene: ENSMUSG00000020916
AA Change: D401G

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
Filament	92	403	4.05e-163	SMART
low complexity region	425	443	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. This type I hair keratin is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperkeratosis affecting the scales of the tail skin and the filiform papillae of the tongue. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,187,458	P720Q	possibly damaging	Het
Acvr1b	G	A	15: 101,210,839	V499M	possibly damaging	Het
Adam5	G	A	8: 24,804,459	Q375*	probably null	Het
Adgrf1	G	A	17: 43,295,164	E60K	probably benign	Het
Alb	T	C	5: 90,462,771	V70A	probably damaging	Het
Aph1b	T	A	9: 66,788,427		probably benign	Het
Aste1	G	A	9: 105,396,990	R143Q	possibly damaging	Het
Aste1	A	T	9: 105,397,796	T351S	probably damaging	Het
Bace2	T	A	16: 97,413,470	L286Q	probably damaging	Het
Bach1	G	A	16: 87,719,275	G235R	probably damaging	Het
Brwd1	A	T	16: 96,047,430	H516Q	probably damaging	Het
Cc2d2a	C	A	5: 43,685,144		probably null	Het
Cdh22	T	A	2: 165,146,726	E236D	probably benign	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Celsr2	T	A	3: 108,398,902	T2029S	probably benign	Het
Col11a1	A	G	3: 114,181,394	D1234G	probably benign	Het
Cpt2	A	G	4: 107,907,760	I269T	probably damaging	Het
Dcaf7	T	A	11: 106,054,793	S323T	probably benign	Het
Ddias	G	T	7: 92,859,400	Q436K	probably benign	Het
Dlec1	G	A	9: 119,143,267		probably null	Het
Dock5	T	A	14: 67,836,410	I294F	probably benign	Het
Fat2	A	T	11: 55,282,968	D2306E	possibly damaging	Het
Gm4787	T	A	12: 81,377,506	D626V	probably damaging	Het
Gm6563	A	G	19: 23,675,926	T27A	probably benign	Het
Hadhb	T	C	5: 30,168,570		probably null	Het
Hsph1	A	T	5: 149,627,564	W406R	probably null	Het
Ighv1-66	C	T	12: 115,593,382	G27R	possibly damaging	Het
Impad1	C	T	4: 4,769,376	M246I	probably benign	Het
Krt26	T	C	11: 99,337,600	E102G	probably damaging	Het
Krt34	T	A	11: 100,040,145		probably null	Het
Loxhd1	G	A	18: 77,431,131	G326S	probably damaging	Het
Lrrc8b	A	G	5: 105,485,936	N758S	probably damaging	Het
Mkl2	A	T	16: 13,384,192		probably null	Het
Muc4	C	T	16: 32,752,993	T957I	probably benign	Het
Naip5	T	C	13: 100,222,235	Y831C	probably damaging	Het
Nfatc1	A	T	18: 80,635,644	V829E	probably benign	Het
Nmnat1	G	A	4: 149,473,370	L72F	possibly damaging	Het
Olfr1316	A	T	2: 112,129,985	D275E	possibly damaging	Het
Pcdh7	T	A	5: 58,129,065	V1161E	probably damaging	Het
Raver1	A	G	9: 21,090,280	Y86H	probably benign	Het
Recql4	G	T	15: 76,704,505	H1035Q	probably benign	Het
Sgsm1	A	T	5: 113,263,418	M814K	probably benign	Het
Sh3d19	T	G	3: 86,084,877	W71G	probably benign	Het
Sidt1	T	C	16: 44,245,166	Y759C	probably damaging	Het
Spg11	G	T	2: 122,113,079	D197E	probably damaging	Het
Sppl2b	TGTCACAGGT	TGT	10: 80,866,069		probably null	Het
Ssc5d	A	T	7: 4,936,329	D588V	probably damaging	Het
Supt20	C	A	3: 54,707,116	T181K	probably damaging	Het
Szt2	A	T	4: 118,386,818	S1363R	probably benign	Het
Tbcel	G	A	9: 42,463,873		probably null	Het
Ube2e3	T	C	2: 78,918,814	L169P	probably damaging	Het
Wrn	A	G	8: 33,288,768	F595S	probably benign	Het
Zfp473	G	T	7: 44,732,899	P670Q	probably damaging	Het
Zw10	C	T	9: 49,074,999	A660V	probably benign	Het

Other mutations in Krt36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00978:Krt36	APN	11	100102948	missense	probably damaging	0.98
IGL01737:Krt36	APN	11	100104120	missense	possibly damaging	0.62
IGL02388:Krt36	APN	11	100105164	nonsense	probably null
IGL02985:Krt36	APN	11	100103179	missense	probably benign	0.32
R0393:Krt36	UTSW	11	100104114	missense	possibly damaging	0.91
R0617:Krt36	UTSW	11	100102275	missense	probably damaging	1.00
R0930:Krt36	UTSW	11	100103399	missense	probably damaging	1.00
R1166:Krt36	UTSW	11	100102828	missense	probably benign	0.00
R1201:Krt36	UTSW	11	100104057	missense	probably benign	0.22
R1587:Krt36	UTSW	11	100102302	missense	probably damaging	1.00
R1750:Krt36	UTSW	11	100104058	missense	probably benign	0.00
R1826:Krt36	UTSW	11	100103030	splice site	probably benign
R1846:Krt36	UTSW	11	100105548	missense	probably damaging	1.00
R2208:Krt36	UTSW	11	100102939	missense	probably damaging	0.96
R4303:Krt36	UTSW	11	100103413	missense	possibly damaging	0.59
R5140:Krt36	UTSW	11	100103502	missense	probably damaging	1.00
R5719:Krt36	UTSW	11	100104161	missense	possibly damaging	0.95
R5944:Krt36	UTSW	11	100105313	missense	probably benign
R6188:Krt36	UTSW	11	100102420	missense	probably benign	0.00
R6271:Krt36	UTSW	11	100104472	nonsense	probably null
R6809:Krt36	UTSW	11	100105509	missense	probably benign	0.00
R6856:Krt36	UTSW	11	100103390	missense	probably damaging	1.00
R7153:Krt36	UTSW	11	100105146	nonsense	probably null
R7602:Krt36	UTSW	11	100102960	missense	probably benign	0.00
R7822:Krt36	UTSW	11	100104140	missense	possibly damaging	0.86
R7894:Krt36	UTSW	11	100105235	missense	probably damaging	1.00
R8234:Krt36	UTSW	11	100104201	missense	probably damaging	1.00
R8904:Krt36	UTSW	11	100105347	missense	probably benign	0.00
R8969:Krt36	UTSW	11	100102303	missense	probably damaging	0.98
R8987:Krt36	UTSW	11	100103546	missense	possibly damaging	0.74
R9297:Krt36	UTSW	11	100103445	missense	probably damaging	1.00
R9314:Krt36	UTSW	11	100103401	nonsense	probably null
R9387:Krt36	UTSW	11	100104080	missense	probably damaging	1.00
R9585:Krt36	UTSW	11	100104066	missense	probably damaging	1.00
Z1088:Krt36	UTSW	11	100104189	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- GAGCTTCCGCCAAAACATG -3'
(R):5'- ATCTACCCTGGCTGAGACAGAG -3'

Sequencing Primer
(F):5'- CCAAAGATGGGCTTGTACCTTG -3'
(R):5'- TGAGACAGAGGCCCGCTAC -3'

Posted On

2021-01-18