Incidental Mutation 'R8480:Krt36'
ID 657488
Institutional Source Beutler Lab
Gene Symbol Krt36
Ensembl Gene ENSMUSG00000020916
Gene Name keratin 36
Synonyms Krt1-5, HRa-1, keratin 5, Krt1-22
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 99992833-99996452 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99993635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 401 (D401G)
Ref Sequence ENSEMBL: ENSMUSP00000103039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107416]
AlphaFold B1AQ75
Predicted Effect possibly damaging
Transcript: ENSMUST00000107416
AA Change: D401G

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103039
Gene: ENSMUSG00000020916
AA Change: D401G

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Filament 92 403 4.05e-163 SMART
low complexity region 425 443 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. This type I hair keratin is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperkeratosis affecting the scales of the tail skin and the filiform papillae of the tongue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b G A 15: 101,108,720 (GRCm39) V499M possibly damaging Het
Adam5 G A 8: 25,294,475 (GRCm39) Q375* probably null Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Aste1 G A 9: 105,274,189 (GRCm39) R143Q possibly damaging Het
Aste1 A T 9: 105,274,995 (GRCm39) T351S probably damaging Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Cdh22 T A 2: 164,988,646 (GRCm39) E236D probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col11a1 A G 3: 113,975,043 (GRCm39) D1234G probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dlec1 G A 9: 118,972,335 (GRCm39) probably null Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm4787 T A 12: 81,424,280 (GRCm39) D626V probably damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Lrrc8b A G 5: 105,633,802 (GRCm39) N758S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Or4f14d A T 2: 111,960,330 (GRCm39) D275E possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Recql4 G T 15: 76,588,705 (GRCm39) H1035Q probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sh3d19 T G 3: 85,992,184 (GRCm39) W71G probably benign Het
Sidt1 T C 16: 44,065,529 (GRCm39) Y759C probably damaging Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Ssc5d A T 7: 4,939,328 (GRCm39) D588V probably damaging Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Szt2 A T 4: 118,244,015 (GRCm39) S1363R probably benign Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zfp473 G T 7: 44,382,323 (GRCm39) P670Q probably damaging Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Krt36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Krt36 APN 11 99,993,774 (GRCm39) missense probably damaging 0.98
IGL01737:Krt36 APN 11 99,994,946 (GRCm39) missense possibly damaging 0.62
IGL02388:Krt36 APN 11 99,995,990 (GRCm39) nonsense probably null
IGL02985:Krt36 APN 11 99,994,005 (GRCm39) missense probably benign 0.32
R0393:Krt36 UTSW 11 99,994,940 (GRCm39) missense possibly damaging 0.91
R0617:Krt36 UTSW 11 99,993,101 (GRCm39) missense probably damaging 1.00
R0930:Krt36 UTSW 11 99,994,225 (GRCm39) missense probably damaging 1.00
R1166:Krt36 UTSW 11 99,993,654 (GRCm39) missense probably benign 0.00
R1201:Krt36 UTSW 11 99,994,883 (GRCm39) missense probably benign 0.22
R1587:Krt36 UTSW 11 99,993,128 (GRCm39) missense probably damaging 1.00
R1750:Krt36 UTSW 11 99,994,884 (GRCm39) missense probably benign 0.00
R1826:Krt36 UTSW 11 99,993,856 (GRCm39) splice site probably benign
R1846:Krt36 UTSW 11 99,996,374 (GRCm39) missense probably damaging 1.00
R2208:Krt36 UTSW 11 99,993,765 (GRCm39) missense probably damaging 0.96
R4303:Krt36 UTSW 11 99,994,239 (GRCm39) missense possibly damaging 0.59
R5140:Krt36 UTSW 11 99,994,328 (GRCm39) missense probably damaging 1.00
R5719:Krt36 UTSW 11 99,994,987 (GRCm39) missense possibly damaging 0.95
R5944:Krt36 UTSW 11 99,996,139 (GRCm39) missense probably benign
R6188:Krt36 UTSW 11 99,993,246 (GRCm39) missense probably benign 0.00
R6271:Krt36 UTSW 11 99,995,298 (GRCm39) nonsense probably null
R6809:Krt36 UTSW 11 99,996,335 (GRCm39) missense probably benign 0.00
R6856:Krt36 UTSW 11 99,994,216 (GRCm39) missense probably damaging 1.00
R7153:Krt36 UTSW 11 99,995,972 (GRCm39) nonsense probably null
R7602:Krt36 UTSW 11 99,993,786 (GRCm39) missense probably benign 0.00
R7822:Krt36 UTSW 11 99,994,966 (GRCm39) missense possibly damaging 0.86
R7894:Krt36 UTSW 11 99,996,061 (GRCm39) missense probably damaging 1.00
R8234:Krt36 UTSW 11 99,995,027 (GRCm39) missense probably damaging 1.00
R8904:Krt36 UTSW 11 99,996,173 (GRCm39) missense probably benign 0.00
R8969:Krt36 UTSW 11 99,993,129 (GRCm39) missense probably damaging 0.98
R8987:Krt36 UTSW 11 99,994,372 (GRCm39) missense possibly damaging 0.74
R9297:Krt36 UTSW 11 99,994,271 (GRCm39) missense probably damaging 1.00
R9314:Krt36 UTSW 11 99,994,227 (GRCm39) nonsense probably null
R9387:Krt36 UTSW 11 99,994,906 (GRCm39) missense probably damaging 1.00
R9585:Krt36 UTSW 11 99,994,892 (GRCm39) missense probably damaging 1.00
Z1088:Krt36 UTSW 11 99,995,015 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GAGCTTCCGCCAAAACATG -3'
(R):5'- ATCTACCCTGGCTGAGACAGAG -3'

Sequencing Primer
(F):5'- CCAAAGATGGGCTTGTACCTTG -3'
(R):5'- TGAGACAGAGGCCCGCTAC -3'
Posted On 2021-01-18