Mutagenetix > Incidental Mutation

Incidental Mutation 'R8480:Dcaf7'

657489

Institutional Source

Beutler Lab

Gene Symbol

Dcaf7

Ensembl Gene

ENSMUSG00000049354

Gene Name

DDB1 and CUL4 associated factor 7

Synonyms

1700012F10Rik, 2610037L01Rik, Wdr68

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8480 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106036872-106059324 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 106054793 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 323 (S323T)

Ref Sequence

ENSEMBL: ENSMUSP00000058168 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058438]

AlphaFold

P61963

Predicted Effect

probably benign
Transcript: ENSMUST00000058438
AA Change: S323T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000058168
Gene: ENSMUSG00000049354
AA Change: S323T

Domain	Start	End	E-Value	Type
WD40	58	99	3.42e1	SMART
WD40	104	149	1.43e1	SMART
WD40	163	205	3.81e-5	SMART
WD40	211	251	1.1e2	SMART
WD40	255	295	8.88e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD40 repeats which facilitate protein-protein interactions and thereby enable the assembly of multiprotein complexes. This protein has been shown to function as a scaffold protein for protein complexes involved in kinase signaling. This highly conserved gene is present in eukaryotic plants, fungi, and animals. The ortholog of this gene was first identified in plants as a key regulator of anthocyanin biosynthesis and flower pigmentation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,187,458	P720Q	possibly damaging	Het
Acvr1b	G	A	15: 101,210,839	V499M	possibly damaging	Het
Adam5	G	A	8: 24,804,459	Q375*	probably null	Het
Adgrf1	G	A	17: 43,295,164	E60K	probably benign	Het
Alb	T	C	5: 90,462,771	V70A	probably damaging	Het
Aph1b	T	A	9: 66,788,427		probably benign	Het
Aste1	G	A	9: 105,396,990	R143Q	possibly damaging	Het
Aste1	A	T	9: 105,397,796	T351S	probably damaging	Het
Bace2	T	A	16: 97,413,470	L286Q	probably damaging	Het
Bach1	G	A	16: 87,719,275	G235R	probably damaging	Het
Brwd1	A	T	16: 96,047,430	H516Q	probably damaging	Het
Cc2d2a	C	A	5: 43,685,144		probably null	Het
Cdh22	T	A	2: 165,146,726	E236D	probably benign	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Celsr2	T	A	3: 108,398,902	T2029S	probably benign	Het
Col11a1	A	G	3: 114,181,394	D1234G	probably benign	Het
Cpt2	A	G	4: 107,907,760	I269T	probably damaging	Het
Ddias	G	T	7: 92,859,400	Q436K	probably benign	Het
Dlec1	G	A	9: 119,143,267		probably null	Het
Dock5	T	A	14: 67,836,410	I294F	probably benign	Het
Fat2	A	T	11: 55,282,968	D2306E	possibly damaging	Het
Gm4787	T	A	12: 81,377,506	D626V	probably damaging	Het
Gm6563	A	G	19: 23,675,926	T27A	probably benign	Het
Hadhb	T	C	5: 30,168,570		probably null	Het
Hsph1	A	T	5: 149,627,564	W406R	probably null	Het
Ighv1-66	C	T	12: 115,593,382	G27R	possibly damaging	Het
Impad1	C	T	4: 4,769,376	M246I	probably benign	Het
Krt26	T	C	11: 99,337,600	E102G	probably damaging	Het
Krt34	T	A	11: 100,040,145		probably null	Het
Krt36	T	C	11: 100,102,809	D401G	possibly damaging	Het
Loxhd1	G	A	18: 77,431,131	G326S	probably damaging	Het
Lrrc8b	A	G	5: 105,485,936	N758S	probably damaging	Het
Mkl2	A	T	16: 13,384,192		probably null	Het
Muc4	C	T	16: 32,752,993	T957I	probably benign	Het
Naip5	T	C	13: 100,222,235	Y831C	probably damaging	Het
Nfatc1	A	T	18: 80,635,644	V829E	probably benign	Het
Nmnat1	G	A	4: 149,473,370	L72F	possibly damaging	Het
Olfr1316	A	T	2: 112,129,985	D275E	possibly damaging	Het
Pcdh7	T	A	5: 58,129,065	V1161E	probably damaging	Het
Raver1	A	G	9: 21,090,280	Y86H	probably benign	Het
Recql4	G	T	15: 76,704,505	H1035Q	probably benign	Het
Sgsm1	A	T	5: 113,263,418	M814K	probably benign	Het
Sh3d19	T	G	3: 86,084,877	W71G	probably benign	Het
Sidt1	T	C	16: 44,245,166	Y759C	probably damaging	Het
Spg11	G	T	2: 122,113,079	D197E	probably damaging	Het
Sppl2b	TGTCACAGGT	TGT	10: 80,866,069		probably null	Het
Ssc5d	A	T	7: 4,936,329	D588V	probably damaging	Het
Supt20	C	A	3: 54,707,116	T181K	probably damaging	Het
Szt2	A	T	4: 118,386,818	S1363R	probably benign	Het
Tbcel	G	A	9: 42,463,873		probably null	Het
Ube2e3	T	C	2: 78,918,814	L169P	probably damaging	Het
Wrn	A	G	8: 33,288,768	F595S	probably benign	Het
Zfp473	G	T	7: 44,732,899	P670Q	probably damaging	Het
Zw10	C	T	9: 49,074,999	A660V	probably benign	Het

Other mutations in Dcaf7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01481:Dcaf7	APN	11	106054746	missense	probably damaging	1.00
IGL01584:Dcaf7	APN	11	106053827	missense	probably benign	0.12
IGL02398:Dcaf7	APN	11	106053753	missense	probably benign	0.03
IGL02516:Dcaf7	APN	11	106051872	missense	probably damaging	1.00
IGL02672:Dcaf7	APN	11	106054858	utr 3 prime	probably benign
IGL02892:Dcaf7	APN	11	106046692	missense	possibly damaging	0.95
IGL02953:Dcaf7	APN	11	106051876	nonsense	probably null
Camomile	UTSW	11	106054722	missense	possibly damaging	0.93
Nescafe	UTSW	11	106051797	missense	probably damaging	0.98
R0179:Dcaf7	UTSW	11	106051797	missense	probably damaging	0.98
R0539:Dcaf7	UTSW	11	106051826	missense	probably damaging	0.98
R1471:Dcaf7	UTSW	11	106046747	missense	probably benign	0.01
R1647:Dcaf7	UTSW	11	106051802	missense	probably damaging	1.00
R1648:Dcaf7	UTSW	11	106051802	missense	probably damaging	1.00
R3551:Dcaf7	UTSW	11	106054796	missense	probably benign	0.00
R4656:Dcaf7	UTSW	11	106053798	missense	probably damaging	1.00
R6167:Dcaf7	UTSW	11	106037251	missense	probably damaging	0.99
R6192:Dcaf7	UTSW	11	106051758	missense	probably damaging	1.00
R6782:Dcaf7	UTSW	11	106054755	missense	probably damaging	1.00
R6864:Dcaf7	UTSW	11	106046821	missense	probably damaging	1.00
R7155:Dcaf7	UTSW	11	106037190	missense	probably damaging	0.97
R7253:Dcaf7	UTSW	11	106047843	splice site	probably null
R7446:Dcaf7	UTSW	11	106053735	missense	probably benign	0.04
R7631:Dcaf7	UTSW	11	106053753	missense	probably benign	0.03
R8109:Dcaf7	UTSW	11	106046778	missense	probably damaging	0.98
R8489:Dcaf7	UTSW	11	106051917	missense	probably damaging	1.00
R8731:Dcaf7	UTSW	11	106054722	missense	possibly damaging	0.93
R8927:Dcaf7	UTSW	11	106051926	missense	probably damaging	1.00
R8928:Dcaf7	UTSW	11	106051926	missense	probably damaging	1.00
R9625:Dcaf7	UTSW	11	106051968	critical splice donor site	probably null
Z1177:Dcaf7	UTSW	11	106053795	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAAATTGTGACTGCCTCTCCAG -3'
(R):5'- GACTTCTACAGCAGCTTCTGAAC -3'

Sequencing Primer
(F):5'- GCCTCTCCAGATGCAAGATTG -3'
(R):5'- CAGCTTCTGAACACAGTGGGTG -3'

Posted On

2021-01-18