Incidental Mutation 'R8480:Dcaf7'
ID657489
Institutional Source Beutler Lab
Gene Symbol Dcaf7
Ensembl Gene ENSMUSG00000049354
Gene NameDDB1 and CUL4 associated factor 7
Synonyms1700012F10Rik, 2610037L01Rik, Wdr68
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8480 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106036872-106059324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106054793 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 323 (S323T)
Ref Sequence ENSEMBL: ENSMUSP00000058168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058438]
Predicted Effect probably benign
Transcript: ENSMUST00000058438
AA Change: S323T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058168
Gene: ENSMUSG00000049354
AA Change: S323T

DomainStartEndE-ValueType
WD40 58 99 3.42e1 SMART
WD40 104 149 1.43e1 SMART
WD40 163 205 3.81e-5 SMART
WD40 211 251 1.1e2 SMART
WD40 255 295 8.88e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD40 repeats which facilitate protein-protein interactions and thereby enable the assembly of multiprotein complexes. This protein has been shown to function as a scaffold protein for protein complexes involved in kinase signaling. This highly conserved gene is present in eukaryotic plants, fungi, and animals. The ortholog of this gene was first identified in plants as a key regulator of anthocyanin biosynthesis and flower pigmentation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,187,458 P720Q possibly damaging Het
Acvr1b G A 15: 101,210,839 V499M possibly damaging Het
Adam5 G A 8: 24,804,459 Q375* probably null Het
Adgrf1 G A 17: 43,295,164 E60K probably benign Het
Alb T C 5: 90,462,771 V70A probably damaging Het
Aph1b T A 9: 66,788,427 probably benign Het
Aste1 G A 9: 105,396,990 R143Q possibly damaging Het
Aste1 A T 9: 105,397,796 T351S probably damaging Het
Bace2 T A 16: 97,413,470 L286Q probably damaging Het
Bach1 G A 16: 87,719,275 G235R probably damaging Het
Brwd1 A T 16: 96,047,430 H516Q probably damaging Het
Cc2d2a C A 5: 43,685,144 probably null Het
Cdh22 T A 2: 165,146,726 E236D probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Col11a1 A G 3: 114,181,394 D1234G probably benign Het
Cpt2 A G 4: 107,907,760 I269T probably damaging Het
Ddias G T 7: 92,859,400 Q436K probably benign Het
Dlec1 G A 9: 119,143,267 probably null Het
Dock5 T A 14: 67,836,410 I294F probably benign Het
Fat2 A T 11: 55,282,968 D2306E possibly damaging Het
Gm4787 T A 12: 81,377,506 D626V probably damaging Het
Gm6563 A G 19: 23,675,926 T27A probably benign Het
Hadhb T C 5: 30,168,570 probably null Het
Hsph1 A T 5: 149,627,564 W406R probably null Het
Ighv1-66 C T 12: 115,593,382 G27R possibly damaging Het
Impad1 C T 4: 4,769,376 M246I probably benign Het
Krt26 T C 11: 99,337,600 E102G probably damaging Het
Krt34 T A 11: 100,040,145 probably null Het
Krt36 T C 11: 100,102,809 D401G possibly damaging Het
Loxhd1 G A 18: 77,431,131 G326S probably damaging Het
Lrrc8b A G 5: 105,485,936 N758S probably damaging Het
Mkl2 A T 16: 13,384,192 probably null Het
Muc4 C T 16: 32,752,993 T957I probably benign Het
Naip5 T C 13: 100,222,235 Y831C probably damaging Het
Nfatc1 A T 18: 80,635,644 V829E probably benign Het
Nmnat1 G A 4: 149,473,370 L72F possibly damaging Het
Olfr1316 A T 2: 112,129,985 D275E possibly damaging Het
Pcdh7 T A 5: 58,129,065 V1161E probably damaging Het
Raver1 A G 9: 21,090,280 Y86H probably benign Het
Recql4 G T 15: 76,704,505 H1035Q probably benign Het
Sgsm1 A T 5: 113,263,418 M814K probably benign Het
Sh3d19 T G 3: 86,084,877 W71G probably benign Het
Sidt1 T C 16: 44,245,166 Y759C probably damaging Het
Spg11 G T 2: 122,113,079 D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Ssc5d A T 7: 4,936,329 D588V probably damaging Het
Supt20 C A 3: 54,707,116 T181K probably damaging Het
Szt2 A T 4: 118,386,818 S1363R probably benign Het
Tbcel G A 9: 42,463,873 probably null Het
Ube2e3 T C 2: 78,918,814 L169P probably damaging Het
Wrn A G 8: 33,288,768 F595S probably benign Het
Zfp473 G T 7: 44,732,899 P670Q probably damaging Het
Zw10 C T 9: 49,074,999 A660V probably benign Het
Other mutations in Dcaf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Dcaf7 APN 11 106054746 missense probably damaging 1.00
IGL01584:Dcaf7 APN 11 106053827 missense probably benign 0.12
IGL02398:Dcaf7 APN 11 106053753 missense probably benign 0.03
IGL02516:Dcaf7 APN 11 106051872 missense probably damaging 1.00
IGL02672:Dcaf7 APN 11 106054858 utr 3 prime probably benign
IGL02892:Dcaf7 APN 11 106046692 missense possibly damaging 0.95
IGL02953:Dcaf7 APN 11 106051876 nonsense probably null
R0179:Dcaf7 UTSW 11 106051797 missense probably damaging 0.98
R0539:Dcaf7 UTSW 11 106051826 missense probably damaging 0.98
R1471:Dcaf7 UTSW 11 106046747 missense probably benign 0.01
R1647:Dcaf7 UTSW 11 106051802 missense probably damaging 1.00
R1648:Dcaf7 UTSW 11 106051802 missense probably damaging 1.00
R3551:Dcaf7 UTSW 11 106054796 missense probably benign 0.00
R4656:Dcaf7 UTSW 11 106053798 missense probably damaging 1.00
R6167:Dcaf7 UTSW 11 106037251 missense probably damaging 0.99
R6192:Dcaf7 UTSW 11 106051758 missense probably damaging 1.00
R6782:Dcaf7 UTSW 11 106054755 missense probably damaging 1.00
R6864:Dcaf7 UTSW 11 106046821 missense probably damaging 1.00
R7155:Dcaf7 UTSW 11 106037190 missense probably damaging 0.97
R7253:Dcaf7 UTSW 11 106047843 splice site probably null
R7446:Dcaf7 UTSW 11 106053735 missense probably benign 0.04
R7631:Dcaf7 UTSW 11 106053753 missense probably benign 0.03
R8109:Dcaf7 UTSW 11 106046778 missense probably damaging 0.98
R8489:Dcaf7 UTSW 11 106051917 missense probably damaging 1.00
R8731:Dcaf7 UTSW 11 106054722 missense possibly damaging 0.93
Z1177:Dcaf7 UTSW 11 106053795 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAATTGTGACTGCCTCTCCAG -3'
(R):5'- GACTTCTACAGCAGCTTCTGAAC -3'

Sequencing Primer
(F):5'- GCCTCTCCAGATGCAAGATTG -3'
(R):5'- CAGCTTCTGAACACAGTGGGTG -3'
Posted On2021-01-18