Incidental Mutation 'R8480:Gm4787'
ID 657490
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Name predicted gene 4787
Synonyms
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 81423765-81426238 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 81424280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 626 (D626V)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
AlphaFold B2RUD9
Predicted Effect probably damaging
Transcript: ENSMUST00000062182
AA Change: D626V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: D626V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b G A 15: 101,108,720 (GRCm39) V499M possibly damaging Het
Adam5 G A 8: 25,294,475 (GRCm39) Q375* probably null Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Aste1 G A 9: 105,274,189 (GRCm39) R143Q possibly damaging Het
Aste1 A T 9: 105,274,995 (GRCm39) T351S probably damaging Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Cdh22 T A 2: 164,988,646 (GRCm39) E236D probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col11a1 A G 3: 113,975,043 (GRCm39) D1234G probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dlec1 G A 9: 118,972,335 (GRCm39) probably null Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Krt36 T C 11: 99,993,635 (GRCm39) D401G possibly damaging Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Lrrc8b A G 5: 105,633,802 (GRCm39) N758S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Or4f14d A T 2: 111,960,330 (GRCm39) D275E possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Recql4 G T 15: 76,588,705 (GRCm39) H1035Q probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sh3d19 T G 3: 85,992,184 (GRCm39) W71G probably benign Het
Sidt1 T C 16: 44,065,529 (GRCm39) Y759C probably damaging Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Ssc5d A T 7: 4,939,328 (GRCm39) D588V probably damaging Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Szt2 A T 4: 118,244,015 (GRCm39) S1363R probably benign Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zfp473 G T 7: 44,382,323 (GRCm39) P670Q probably damaging Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81,423,948 (GRCm39) missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81,424,218 (GRCm39) missense probably benign 0.36
IGL02193:Gm4787 APN 12 81,425,302 (GRCm39) missense probably benign 0.02
IGL02623:Gm4787 APN 12 81,425,502 (GRCm39) missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81,425,543 (GRCm39) missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81,424,826 (GRCm39) missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81,425,948 (GRCm39) missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
PIT4362001:Gm4787 UTSW 12 81,423,949 (GRCm39) missense probably benign
R0070:Gm4787 UTSW 12 81,425,840 (GRCm39) missense probably damaging 1.00
R0128:Gm4787 UTSW 12 81,424,521 (GRCm39) nonsense probably null
R0220:Gm4787 UTSW 12 81,425,422 (GRCm39) missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81,425,708 (GRCm39) missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81,425,086 (GRCm39) missense probably benign 0.03
R1761:Gm4787 UTSW 12 81,423,950 (GRCm39) missense probably benign 0.02
R1809:Gm4787 UTSW 12 81,425,303 (GRCm39) missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81,425,108 (GRCm39) missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81,425,108 (GRCm39) missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81,425,544 (GRCm39) missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81,425,694 (GRCm39) missense probably benign 0.39
R2112:Gm4787 UTSW 12 81,424,607 (GRCm39) missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81,425,336 (GRCm39) missense probably benign 0.03
R2151:Gm4787 UTSW 12 81,423,993 (GRCm39) missense probably benign 0.00
R2152:Gm4787 UTSW 12 81,423,993 (GRCm39) missense probably benign 0.00
R2342:Gm4787 UTSW 12 81,425,532 (GRCm39) missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81,425,911 (GRCm39) missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81,425,132 (GRCm39) missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81,425,987 (GRCm39) missense probably benign 0.17
R4748:Gm4787 UTSW 12 81,424,830 (GRCm39) missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81,425,141 (GRCm39) missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81,425,612 (GRCm39) missense probably benign 0.03
R4960:Gm4787 UTSW 12 81,426,090 (GRCm39) missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81,424,403 (GRCm39) missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5029:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5031:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5098:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5099:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5100:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5101:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5135:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5152:Gm4787 UTSW 12 81,425,451 (GRCm39) missense probably benign 0.02
R5180:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5220:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5257:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5258:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5297:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5324:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5325:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5355:Gm4787 UTSW 12 81,424,239 (GRCm39) nonsense probably null
R5364:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5396:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5397:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5398:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5514:Gm4787 UTSW 12 81,425,102 (GRCm39) missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5666:Gm4787 UTSW 12 81,424,805 (GRCm39) missense probably benign 0.23
R5670:Gm4787 UTSW 12 81,424,805 (GRCm39) missense probably benign 0.23
R5787:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5788:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R6354:Gm4787 UTSW 12 81,424,755 (GRCm39) missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81,425,974 (GRCm39) missense probably benign 0.04
R7120:Gm4787 UTSW 12 81,425,260 (GRCm39) missense probably benign 0.00
R7237:Gm4787 UTSW 12 81,424,442 (GRCm39) missense probably damaging 0.99
R7937:Gm4787 UTSW 12 81,424,679 (GRCm39) missense probably benign 0.01
R8022:Gm4787 UTSW 12 81,424,494 (GRCm39) missense possibly damaging 0.94
R8140:Gm4787 UTSW 12 81,424,925 (GRCm39) missense probably benign 0.00
R8314:Gm4787 UTSW 12 81,425,909 (GRCm39) missense probably damaging 1.00
R8498:Gm4787 UTSW 12 81,425,840 (GRCm39) missense probably damaging 1.00
R8515:Gm4787 UTSW 12 81,424,043 (GRCm39) missense probably benign 0.00
R9103:Gm4787 UTSW 12 81,425,489 (GRCm39) missense probably benign 0.06
R9457:Gm4787 UTSW 12 81,426,020 (GRCm39) missense probably damaging 1.00
R9557:Gm4787 UTSW 12 81,426,074 (GRCm39) nonsense probably null
R9608:Gm4787 UTSW 12 81,425,086 (GRCm39) missense probably benign 0.03
V7580:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
V7581:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
V7582:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGGCCACTGTTTACACTAC -3'
(R):5'- AGGAGGAAGCCAAACTGTCC -3'

Sequencing Primer
(F):5'- ACTACCACCTTTTCCTCTTTGTAAAC -3'
(R):5'- CTGTCCCATGTCAAAAGGAGG -3'
Posted On 2021-01-18