Mutagenetix > Incidental Mutation

Incidental Mutation 'R8480:Naip5'

657492

Institutional Source

Beutler Lab

Gene Symbol

Naip5

Ensembl Gene

ENSMUSG00000071203

Gene Name

NLR family, apoptosis inhibitory protein 5

Synonyms

Birc1e, Lgn1, Naip-rs3

MMRRC Submission

067924-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R8480 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

100211739-100246323 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100222235 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 831 (Y831C)

Ref Sequence

ENSEMBL: ENSMUSP00000058611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049789]

AlphaFold

Q9R016

Predicted Effect

probably damaging
Transcript: ENSMUST00000049789
AA Change: Y831C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: Y831C

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
BIR	58	129	1.08e-19	SMART
BIR	157	229	1.06e-36	SMART
BIR	276	347	2.14e-32	SMART
Pfam:NACHT	464	618	1.7e-36	PFAM
low complexity region	851	862	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (53/54)

MGI Phenotype

PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,187,458	P720Q	possibly damaging	Het
Acvr1b	G	A	15: 101,210,839	V499M	possibly damaging	Het
Adam5	G	A	8: 24,804,459	Q375*	probably null	Het
Adgrf1	G	A	17: 43,295,164	E60K	probably benign	Het
Alb	T	C	5: 90,462,771	V70A	probably damaging	Het
Aph1b	T	A	9: 66,788,427		probably benign	Het
Aste1	G	A	9: 105,396,990	R143Q	possibly damaging	Het
Aste1	A	T	9: 105,397,796	T351S	probably damaging	Het
Bace2	T	A	16: 97,413,470	L286Q	probably damaging	Het
Bach1	G	A	16: 87,719,275	G235R	probably damaging	Het
Brwd1	A	T	16: 96,047,430	H516Q	probably damaging	Het
Cc2d2a	C	A	5: 43,685,144		probably null	Het
Cdh22	T	A	2: 165,146,726	E236D	probably benign	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Celsr2	T	A	3: 108,398,902	T2029S	probably benign	Het
Col11a1	A	G	3: 114,181,394	D1234G	probably benign	Het
Cpt2	A	G	4: 107,907,760	I269T	probably damaging	Het
Dcaf7	T	A	11: 106,054,793	S323T	probably benign	Het
Ddias	G	T	7: 92,859,400	Q436K	probably benign	Het
Dlec1	G	A	9: 119,143,267		probably null	Het
Dock5	T	A	14: 67,836,410	I294F	probably benign	Het
Fat2	A	T	11: 55,282,968	D2306E	possibly damaging	Het
Gm4787	T	A	12: 81,377,506	D626V	probably damaging	Het
Gm6563	A	G	19: 23,675,926	T27A	probably benign	Het
Hadhb	T	C	5: 30,168,570		probably null	Het
Hsph1	A	T	5: 149,627,564	W406R	probably null	Het
Ighv1-66	C	T	12: 115,593,382	G27R	possibly damaging	Het
Impad1	C	T	4: 4,769,376	M246I	probably benign	Het
Krt26	T	C	11: 99,337,600	E102G	probably damaging	Het
Krt34	T	A	11: 100,040,145		probably null	Het
Krt36	T	C	11: 100,102,809	D401G	possibly damaging	Het
Loxhd1	G	A	18: 77,431,131	G326S	probably damaging	Het
Lrrc8b	A	G	5: 105,485,936	N758S	probably damaging	Het
Mkl2	A	T	16: 13,384,192		probably null	Het
Muc4	C	T	16: 32,752,993	T957I	probably benign	Het
Nfatc1	A	T	18: 80,635,644	V829E	probably benign	Het
Nmnat1	G	A	4: 149,473,370	L72F	possibly damaging	Het
Olfr1316	A	T	2: 112,129,985	D275E	possibly damaging	Het
Pcdh7	T	A	5: 58,129,065	V1161E	probably damaging	Het
Raver1	A	G	9: 21,090,280	Y86H	probably benign	Het
Recql4	G	T	15: 76,704,505	H1035Q	probably benign	Het
Sgsm1	A	T	5: 113,263,418	M814K	probably benign	Het
Sh3d19	T	G	3: 86,084,877	W71G	probably benign	Het
Sidt1	T	C	16: 44,245,166	Y759C	probably damaging	Het
Spg11	G	T	2: 122,113,079	D197E	probably damaging	Het
Sppl2b	TGTCACAGGT	TGT	10: 80,866,069		probably null	Het
Ssc5d	A	T	7: 4,936,329	D588V	probably damaging	Het
Supt20	C	A	3: 54,707,116	T181K	probably damaging	Het
Szt2	A	T	4: 118,386,818	S1363R	probably benign	Het
Tbcel	G	A	9: 42,463,873		probably null	Het
Ube2e3	T	C	2: 78,918,814	L169P	probably damaging	Het
Wrn	A	G	8: 33,288,768	F595S	probably benign	Het
Zfp473	G	T	7: 44,732,899	P670Q	probably damaging	Het
Zw10	C	T	9: 49,074,999	A660V	probably benign	Het

Other mutations in Naip5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Naip5	APN	13	100246175	nonsense	probably null
IGL00493:Naip5	APN	13	100230771	missense	probably damaging	0.96
IGL01294:Naip5	APN	13	100217080	missense	probably damaging	0.99
IGL01405:Naip5	APN	13	100221945	missense	probably benign	0.11
IGL01568:Naip5	APN	13	100217101	missense	probably benign	0.26
IGL01804:Naip5	APN	13	100221584	missense	probably damaging	1.00
IGL02012:Naip5	APN	13	100223339	missense	probably benign	0.01
IGL02183:Naip5	APN	13	100221642	missense	probably benign	0.41
IGL02449:Naip5	APN	13	100222175	missense	probably benign	0.34
IGL02815:Naip5	APN	13	100222731	missense	probably benign
IGL02992:Naip5	APN	13	100223028	missense	probably damaging	1.00
IGL03027:Naip5	APN	13	100223016	missense	probably benign	0.00
IGL03234:Naip5	APN	13	100212627	missense	probably damaging	1.00
inwood2	UTSW	13	100223014	nonsense	probably null
inwood3	UTSW	13	100221903	nonsense	probably null
Nuchal	UTSW	13	100214663	missense	possibly damaging	0.82
PIT4131001:Naip5	UTSW	13	100219739	missense	probably benign
PIT4131001:Naip5	UTSW	13	100219760	missense	probably benign	0.00
R0001:Naip5	UTSW	13	100214650	critical splice donor site	probably null
R0001:Naip5	UTSW	13	100223114	missense	probably benign
R0462:Naip5	UTSW	13	100221732	missense	probably damaging	1.00
R0636:Naip5	UTSW	13	100219688	missense	probably benign
R0674:Naip5	UTSW	13	100223199	missense	probably benign	0.04
R0764:Naip5	UTSW	13	100217105	missense	probably benign	0.03
R0837:Naip5	UTSW	13	100230743	missense	probably benign
R1179:Naip5	UTSW	13	100219830	missense	probably benign
R1302:Naip5	UTSW	13	100221591	missense	possibly damaging	0.91
R1441:Naip5	UTSW	13	100219717	missense	possibly damaging	0.95
R1513:Naip5	UTSW	13	100222206	missense	probably benign
R1638:Naip5	UTSW	13	100212669	missense	probably damaging	1.00
R1651:Naip5	UTSW	13	100221911	missense	probably benign	0.41
R1707:Naip5	UTSW	13	100242855	missense	probably damaging	1.00
R1835:Naip5	UTSW	13	100223218	nonsense	probably null
R1836:Naip5	UTSW	13	100219687	missense	probably benign	0.18
R1972:Naip5	UTSW	13	100212770	missense	probably damaging	0.98
R2080:Naip5	UTSW	13	100221533	missense	probably damaging	1.00
R2333:Naip5	UTSW	13	100223171	missense	probably damaging	1.00
R2348:Naip5	UTSW	13	100219738	missense	probably benign	0.01
R3055:Naip5	UTSW	13	100221878	missense	probably benign	0.23
R3401:Naip5	UTSW	13	100221903	nonsense	probably null
R3723:Naip5	UTSW	13	100223014	nonsense	probably null
R3775:Naip5	UTSW	13	100223375	missense	probably benign	0.00
R3775:Naip5	UTSW	13	100223394	missense	probably benign	0.00
R4019:Naip5	UTSW	13	100223375	missense	probably benign	0.00
R4019:Naip5	UTSW	13	100223394	missense	probably benign	0.00
R4020:Naip5	UTSW	13	100223375	missense	probably benign	0.00
R4020:Naip5	UTSW	13	100223394	missense	probably benign	0.00
R4074:Naip5	UTSW	13	100246064	missense	probably damaging	1.00
R4082:Naip5	UTSW	13	100245830	missense	probably damaging	1.00
R4105:Naip5	UTSW	13	100219739	missense	probably benign
R4227:Naip5	UTSW	13	100212768	missense	probably damaging	0.99
R4639:Naip5	UTSW	13	100219830	missense	probably benign
R4640:Naip5	UTSW	13	100219830	missense	probably benign
R4641:Naip5	UTSW	13	100219830	missense	probably benign
R4644:Naip5	UTSW	13	100219830	missense	probably benign
R4645:Naip5	UTSW	13	100219830	missense	probably benign
R4700:Naip5	UTSW	13	100223414	missense	possibly damaging	0.62
R4727:Naip5	UTSW	13	100221870	missense	possibly damaging	0.81
R4729:Naip5	UTSW	13	100222131	missense	possibly damaging	0.75
R4816:Naip5	UTSW	13	100219681	missense	probably benign	0.32
R4816:Naip5	UTSW	13	100219687	missense	probably benign	0.01
R4816:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R4869:Naip5	UTSW	13	100245131	missense	probably damaging	1.00
R5162:Naip5	UTSW	13	100223406	missense	possibly damaging	0.78
R5244:Naip5	UTSW	13	100245662	missense	probably benign	0.08
R5411:Naip5	UTSW	13	100245746	missense	possibly damaging	0.54
R5632:Naip5	UTSW	13	100230662	splice site	probably null
R5760:Naip5	UTSW	13	100242838	missense	probably damaging	1.00
R5916:Naip5	UTSW	13	100222701	missense	probably benign	0.02
R6302:Naip5	UTSW	13	100223166	missense	possibly damaging	0.76
R6304:Naip5	UTSW	13	100223166	missense	possibly damaging	0.76
R6411:Naip5	UTSW	13	100223405	missense	probably benign	0.01
R6474:Naip5	UTSW	13	100214663	missense	possibly damaging	0.82
R6499:Naip5	UTSW	13	100221594	missense	probably benign
R6544:Naip5	UTSW	13	100223144	missense	possibly damaging	0.50
R6827:Naip5	UTSW	13	100245929	missense	possibly damaging	0.48
R6954:Naip5	UTSW	13	100223414	missense	probably damaging	0.99
R7052:Naip5	UTSW	13	100222347	missense	probably benign	0.01
R7138:Naip5	UTSW	13	100219830	missense	probably benign
R7141:Naip5	UTSW	13	100219830	missense	probably benign
R7375:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7375:Naip5	UTSW	13	100219697	missense	not run
R7401:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7401:Naip5	UTSW	13	100219697	missense	not run
R7447:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7447:Naip5	UTSW	13	100219697	missense	not run
R7466:Naip5	UTSW	13	100221986	nonsense	probably null
R7491:Naip5	UTSW	13	100217071	missense	probably benign	0.18
R7559:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7559:Naip5	UTSW	13	100219697	missense	not run
R7562:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7562:Naip5	UTSW	13	100219697	missense	not run
R7588:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7588:Naip5	UTSW	13	100219697	missense	not run
R7589:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7589:Naip5	UTSW	13	100219697	missense	not run
R7590:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7590:Naip5	UTSW	13	100219697	missense	not run
R7742:Naip5	UTSW	13	100219830	missense	probably benign
R7886:Naip5	UTSW	13	100246181	missense	probably benign	0.28
R7996:Naip5	UTSW	13	100221656	missense	probably damaging	1.00
R8026:Naip5	UTSW	13	100245898	missense	probably damaging	1.00
R8046:Naip5	UTSW	13	100222233	missense	probably benign
R8319:Naip5	UTSW	13	100221659	missense	probably benign	0.12
R8471:Naip5	UTSW	13	100221645	missense	probably damaging	0.99
R8496:Naip5	UTSW	13	100212739	missense	probably benign	0.00
R8500:Naip5	UTSW	13	100222712	missense	probably damaging	0.98
R8712:Naip5	UTSW	13	100223096	missense	possibly damaging	0.61
R8780:Naip5	UTSW	13	100219830	missense	probably benign
R8781:Naip5	UTSW	13	100219830	missense	probably benign
R8788:Naip5	UTSW	13	100219830	missense	probably benign
R8817:Naip5	UTSW	13	100212699	missense	probably benign	0.01
R8833:Naip5	UTSW	13	100222934	missense	probably damaging	0.97
R8835:Naip5	UTSW	13	100219830	missense	probably benign
R8958:Naip5	UTSW	13	100217609	nonsense	probably null
R9031:Naip5	UTSW	13	100219830	missense	probably benign
R9032:Naip5	UTSW	13	100219830	missense	probably benign
R9074:Naip5	UTSW	13	100221756	missense	possibly damaging	0.92
R9098:Naip5	UTSW	13	100229619	missense	possibly damaging	0.67
R9204:Naip5	UTSW	13	100222500	missense	probably damaging	1.00
R9223:Naip5	UTSW	13	100227676	missense	probably benign	0.05
R9358:Naip5	UTSW	13	100219830	missense	probably benign
R9389:Naip5	UTSW	13	100219830	missense	probably benign
R9403:Naip5	UTSW	13	100219830	missense	probably benign
R9518:Naip5	UTSW	13	100221859	missense	probably benign
R9568:Naip5	UTSW	13	100219830	missense	probably benign
R9568:Naip5	UTSW	13	100223313	missense	probably benign	0.00
R9569:Naip5	UTSW	13	100219830	missense	probably benign
R9569:Naip5	UTSW	13	100223313	missense	probably benign	0.00
R9570:Naip5	UTSW	13	100223313	missense	probably benign	0.00
R9572:Naip5	UTSW	13	100223313	missense	probably benign	0.00
R9581:Naip5	UTSW	13	100214686	missense	probably benign	0.11
R9627:Naip5	UTSW	13	100219830	missense	probably benign
R9725:Naip5	UTSW	13	100222276	missense	possibly damaging	0.94
R9763:Naip5	UTSW	13	100230761	missense	probably damaging	0.99
R9764:Naip5	UTSW	13	100230761	missense	probably damaging	0.99
R9765:Naip5	UTSW	13	100230761	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTCCTCAACAGTAACAGGC -3'
(R):5'- CCTGAGTTCAGATAGGCAGG -3'

Sequencing Primer
(F):5'- AAAGCCAGTGTTTTTCCTCGAAGG -3'
(R):5'- CCTGAGTTCAGATAGGCAGGAAGAC -3'

Posted On

2021-01-18