Incidental Mutation 'R8480:Dock5'
ID 657493
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms lr2, 1110060D06Rik, rlc
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 67752135-67933442 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 67836410 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 294 (I294F)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect probably benign
Transcript: ENSMUST00000039135
AA Change: I294F

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: I294F

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,187,458 P720Q possibly damaging Het
Acvr1b G A 15: 101,210,839 V499M possibly damaging Het
Adam5 G A 8: 24,804,459 Q375* probably null Het
Adgrf1 G A 17: 43,295,164 E60K probably benign Het
Alb T C 5: 90,462,771 V70A probably damaging Het
Aph1b T A 9: 66,788,427 probably benign Het
Aste1 G A 9: 105,396,990 R143Q possibly damaging Het
Aste1 A T 9: 105,397,796 T351S probably damaging Het
Bace2 T A 16: 97,413,470 L286Q probably damaging Het
Bach1 G A 16: 87,719,275 G235R probably damaging Het
Brwd1 A T 16: 96,047,430 H516Q probably damaging Het
Cc2d2a C A 5: 43,685,144 probably null Het
Cdh22 T A 2: 165,146,726 E236D probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Col11a1 A G 3: 114,181,394 D1234G probably benign Het
Cpt2 A G 4: 107,907,760 I269T probably damaging Het
Dcaf7 T A 11: 106,054,793 S323T probably benign Het
Ddias G T 7: 92,859,400 Q436K probably benign Het
Dlec1 G A 9: 119,143,267 probably null Het
Fat2 A T 11: 55,282,968 D2306E possibly damaging Het
Gm4787 T A 12: 81,377,506 D626V probably damaging Het
Gm6563 A G 19: 23,675,926 T27A probably benign Het
Hadhb T C 5: 30,168,570 probably null Het
Hsph1 A T 5: 149,627,564 W406R probably null Het
Ighv1-66 C T 12: 115,593,382 G27R possibly damaging Het
Impad1 C T 4: 4,769,376 M246I probably benign Het
Krt26 T C 11: 99,337,600 E102G probably damaging Het
Krt34 T A 11: 100,040,145 probably null Het
Krt36 T C 11: 100,102,809 D401G possibly damaging Het
Loxhd1 G A 18: 77,431,131 G326S probably damaging Het
Lrrc8b A G 5: 105,485,936 N758S probably damaging Het
Mkl2 A T 16: 13,384,192 probably null Het
Muc4 C T 16: 32,752,993 T957I probably benign Het
Naip5 T C 13: 100,222,235 Y831C probably damaging Het
Nfatc1 A T 18: 80,635,644 V829E probably benign Het
Nmnat1 G A 4: 149,473,370 L72F possibly damaging Het
Olfr1316 A T 2: 112,129,985 D275E possibly damaging Het
Pcdh7 T A 5: 58,129,065 V1161E probably damaging Het
Raver1 A G 9: 21,090,280 Y86H probably benign Het
Recql4 G T 15: 76,704,505 H1035Q probably benign Het
Sgsm1 A T 5: 113,263,418 M814K probably benign Het
Sh3d19 T G 3: 86,084,877 W71G probably benign Het
Sidt1 T C 16: 44,245,166 Y759C probably damaging Het
Spg11 G T 2: 122,113,079 D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Ssc5d A T 7: 4,936,329 D588V probably damaging Het
Supt20 C A 3: 54,707,116 T181K probably damaging Het
Szt2 A T 4: 118,386,818 S1363R probably benign Het
Tbcel G A 9: 42,463,873 probably null Het
Ube2e3 T C 2: 78,918,814 L169P probably damaging Het
Wrn A G 8: 33,288,768 F595S probably benign Het
Zfp473 G T 7: 44,732,899 P670Q probably damaging Het
Zw10 C T 9: 49,074,999 A660V probably benign Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67786889 splice site probably benign
IGL00930:Dock5 APN 14 67771077 missense probably damaging 1.00
IGL01525:Dock5 APN 14 67805720 splice site probably benign
IGL01759:Dock5 APN 14 67881259 nonsense probably null
IGL01941:Dock5 APN 14 67812232 missense probably damaging 1.00
IGL02025:Dock5 APN 14 67763287 missense probably damaging 1.00
IGL02093:Dock5 APN 14 67839543 splice site probably benign
IGL02179:Dock5 APN 14 67806496 splice site probably benign
IGL02208:Dock5 APN 14 67828450 missense probably benign 0.06
IGL02605:Dock5 APN 14 67828438 missense probably benign 0.18
IGL02608:Dock5 APN 14 67828439 missense probably benign 0.01
IGL02938:Dock5 APN 14 67757218 splice site probably benign
IGL02971:Dock5 APN 14 67757109 missense probably null 1.00
IGL02983:Dock5 APN 14 67764670 missense probably damaging 1.00
IGL03151:Dock5 APN 14 67866067 missense probably damaging 1.00
IGL03410:Dock5 APN 14 67846086 missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67824674 missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67846081 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0112:Dock5 UTSW 14 67819641 missense probably benign
R0127:Dock5 UTSW 14 67846042 missense probably benign 0.13
R0144:Dock5 UTSW 14 67786286 missense probably benign 0.18
R0312:Dock5 UTSW 14 67795991 missense possibly damaging 0.82
R0360:Dock5 UTSW 14 67822680 splice site probably benign
R0364:Dock5 UTSW 14 67822680 splice site probably benign
R0496:Dock5 UTSW 14 67817518 missense probably damaging 1.00
R0506:Dock5 UTSW 14 67784792 splice site probably benign
R0586:Dock5 UTSW 14 67809032 missense probably damaging 1.00
R0597:Dock5 UTSW 14 67784934 splice site probably null
R0625:Dock5 UTSW 14 67841163 missense probably benign
R1109:Dock5 UTSW 14 67806478 missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67759161 missense probably benign 0.00
R1278:Dock5 UTSW 14 67839566 missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67846062 missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67757135 nonsense probably null
R1946:Dock5 UTSW 14 67786316 missense probably damaging 1.00
R2046:Dock5 UTSW 14 67812142 missense probably benign
R2101:Dock5 UTSW 14 67794010 missense probably benign 0.02
R2252:Dock5 UTSW 14 67784812 missense probably damaging 0.98
R2882:Dock5 UTSW 14 67839620 missense probably damaging 0.99
R3110:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67756492 missense probably benign 0.02
R4242:Dock5 UTSW 14 67828490 missense probably benign 0.19
R4244:Dock5 UTSW 14 67774582 missense probably benign 0.41
R4646:Dock5 UTSW 14 67842779 missense probably benign 0.01
R4793:Dock5 UTSW 14 67800354 missense probably benign 0.26
R4841:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R4842:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R5159:Dock5 UTSW 14 67792289 missense probably benign 0.04
R5164:Dock5 UTSW 14 67817661 nonsense probably null
R5206:Dock5 UTSW 14 67763184 missense probably benign 0.35
R5207:Dock5 UTSW 14 67776284 missense probably benign 0.06
R5322:Dock5 UTSW 14 67770266 missense probably benign 0.41
R5374:Dock5 UTSW 14 67805756 missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67764655 missense probably damaging 1.00
R5476:Dock5 UTSW 14 67814007 missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67803086 missense probably benign 0.01
R5677:Dock5 UTSW 14 67777603 missense probably benign 0.00
R5773:Dock5 UTSW 14 67796058 missense possibly damaging 0.95
R5845:Dock5 UTSW 14 67841101 missense possibly damaging 0.82
R5957:Dock5 UTSW 14 67857994 missense probably benign
R6154:Dock5 UTSW 14 67859912 missense probably benign 0.03
R6268:Dock5 UTSW 14 67790275 nonsense probably null
R6393:Dock5 UTSW 14 67822602 missense probably benign 0.32
R6512:Dock5 UTSW 14 67824648 missense possibly damaging 0.93
R6759:Dock5 UTSW 14 67795996 missense probably benign 0.00
R7012:Dock5 UTSW 14 67822586 missense probably damaging 1.00
R7061:Dock5 UTSW 14 67770254 missense probably damaging 0.96
R7196:Dock5 UTSW 14 67756470 missense probably damaging 1.00
R7200:Dock5 UTSW 14 67771702 nonsense probably null
R7311:Dock5 UTSW 14 67828502 missense probably benign 0.25
R7359:Dock5 UTSW 14 67765888 missense probably benign 0.10
R7422:Dock5 UTSW 14 67809030 missense probably benign 0.01
R7588:Dock5 UTSW 14 67763158 critical splice donor site probably null
R7637:Dock5 UTSW 14 67786340 missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67796005 missense probably benign 0.44
R7763:Dock5 UTSW 14 67821327 missense probably damaging 0.97
R8044:Dock5 UTSW 14 67824692 missense probably damaging 1.00
R8076:Dock5 UTSW 14 67802977 splice site probably null
R8168:Dock5 UTSW 14 67770197 splice site probably null
R8353:Dock5 UTSW 14 67817508 splice site probably null
R8535:Dock5 UTSW 14 67793976 missense probably benign 0.19
R8708:Dock5 UTSW 14 67767371 missense probably benign 0.02
R8732:Dock5 UTSW 14 67846000 missense possibly damaging 0.85
R8888:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8895:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8936:Dock5 UTSW 14 67845990 nonsense probably null
R8962:Dock5 UTSW 14 67757191 missense probably benign
R8972:Dock5 UTSW 14 67776300 missense probably damaging 1.00
R9244:Dock5 UTSW 14 67759114 missense probably damaging 0.99
R9345:Dock5 UTSW 14 67822622 missense possibly damaging 0.74
R9679:Dock5 UTSW 14 67781001 missense probably damaging 1.00
X0023:Dock5 UTSW 14 67771088 missense probably benign 0.15
Z1177:Dock5 UTSW 14 67813933 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCCAGTCAGCCACCTTCT -3'
(R):5'- CCAGGGAAGAAAAGAAGACTGTTTTAT -3'

Sequencing Primer
(F):5'- GGCGTGAGTCAGAAATTCCTTCC -3'
(R):5'- CTCTGTAATTCTTAGATGGGC -3'
Posted On 2021-01-18