Incidental Mutation 'R8480:Recql4'
ID 657495
Institutional Source Beutler Lab
Gene Symbol Recql4
Ensembl Gene ENSMUSG00000033762
Gene Name RecQ protein-like 4
Synonyms
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 76587753-76594748 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 76588705 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1035 (H1035Q)
Ref Sequence ENSEMBL: ENSMUSP00000155694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019224] [ENSMUST00000023203] [ENSMUST00000036852] [ENSMUST00000229140] [ENSMUST00000229679] [ENSMUST00000229734] [ENSMUST00000230544] [ENSMUST00000230724]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000019224
SMART Domains Protein: ENSMUSP00000019224
Gene: ENSMUSG00000019080

DomainStartEndE-ValueType
Pfam:MFS_1 8 373 3e-16 PFAM
transmembrane domain 388 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023203
SMART Domains Protein: ENSMUSP00000023203
Gene: ENSMUSG00000022546

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 83 484 7.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036852
AA Change: H1078Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762
AA Change: H1078Q

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000229140
Predicted Effect probably benign
Transcript: ENSMUST00000229679
Predicted Effect probably benign
Transcript: ENSMUST00000229734
Predicted Effect probably benign
Transcript: ENSMUST00000230544
AA Change: H1035Q

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000230724
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous loss of exons 5-8 causes embryonic death. Deletion of exon 13 causes neo- and postnatal lethality, stunted growth, skin, hair and bone defects, tissue hypoplasia and tooth dysgenesis. Mice lacking exons 9-13 show palate and limb defects, aneuploidy, poikiloderma and cancer predisposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b G A 15: 101,108,720 (GRCm39) V499M possibly damaging Het
Adam5 G A 8: 25,294,475 (GRCm39) Q375* probably null Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Aste1 G A 9: 105,274,189 (GRCm39) R143Q possibly damaging Het
Aste1 A T 9: 105,274,995 (GRCm39) T351S probably damaging Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Cdh22 T A 2: 164,988,646 (GRCm39) E236D probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col11a1 A G 3: 113,975,043 (GRCm39) D1234G probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dlec1 G A 9: 118,972,335 (GRCm39) probably null Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm4787 T A 12: 81,424,280 (GRCm39) D626V probably damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Krt36 T C 11: 99,993,635 (GRCm39) D401G possibly damaging Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Lrrc8b A G 5: 105,633,802 (GRCm39) N758S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Or4f14d A T 2: 111,960,330 (GRCm39) D275E possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sh3d19 T G 3: 85,992,184 (GRCm39) W71G probably benign Het
Sidt1 T C 16: 44,065,529 (GRCm39) Y759C probably damaging Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Ssc5d A T 7: 4,939,328 (GRCm39) D588V probably damaging Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Szt2 A T 4: 118,244,015 (GRCm39) S1363R probably benign Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zfp473 G T 7: 44,382,323 (GRCm39) P670Q probably damaging Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Recql4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Recql4 APN 15 76,591,536 (GRCm39) missense possibly damaging 0.52
IGL01287:Recql4 APN 15 76,594,112 (GRCm39) splice site probably benign
IGL01470:Recql4 APN 15 76,593,144 (GRCm39) missense probably benign 0.40
IGL01809:Recql4 APN 15 76,593,070 (GRCm39) nonsense probably null
IGL02094:Recql4 APN 15 76,593,717 (GRCm39) missense probably benign 0.01
IGL02303:Recql4 APN 15 76,592,771 (GRCm39) missense possibly damaging 0.64
IGL02702:Recql4 APN 15 76,591,485 (GRCm39) missense probably damaging 1.00
IGL03086:Recql4 APN 15 76,590,468 (GRCm39) missense probably benign 0.30
IGL03162:Recql4 APN 15 76,590,296 (GRCm39) splice site probably null
ANU74:Recql4 UTSW 15 76,589,957 (GRCm39) missense possibly damaging 0.47
F5770:Recql4 UTSW 15 76,590,369 (GRCm39) missense possibly damaging 0.79
R0688:Recql4 UTSW 15 76,594,009 (GRCm39) splice site probably null
R1171:Recql4 UTSW 15 76,588,239 (GRCm39) missense possibly damaging 0.94
R1348:Recql4 UTSW 15 76,593,411 (GRCm39) missense probably benign 0.01
R1487:Recql4 UTSW 15 76,593,183 (GRCm39) missense probably benign 0.11
R1547:Recql4 UTSW 15 76,590,511 (GRCm39) missense probably damaging 0.99
R1917:Recql4 UTSW 15 76,588,037 (GRCm39) nonsense probably null
R3813:Recql4 UTSW 15 76,588,694 (GRCm39) missense possibly damaging 0.67
R4066:Recql4 UTSW 15 76,590,027 (GRCm39) missense probably damaging 1.00
R4363:Recql4 UTSW 15 76,590,244 (GRCm39) missense probably benign 0.07
R4387:Recql4 UTSW 15 76,590,158 (GRCm39) missense probably benign 0.00
R4388:Recql4 UTSW 15 76,590,158 (GRCm39) missense probably benign 0.00
R4700:Recql4 UTSW 15 76,592,785 (GRCm39) missense probably damaging 1.00
R4701:Recql4 UTSW 15 76,592,785 (GRCm39) missense probably damaging 1.00
R4923:Recql4 UTSW 15 76,594,381 (GRCm39) missense probably damaging 1.00
R5075:Recql4 UTSW 15 76,593,744 (GRCm39) missense probably damaging 1.00
R5103:Recql4 UTSW 15 76,590,956 (GRCm39) missense probably damaging 1.00
R5226:Recql4 UTSW 15 76,594,329 (GRCm39) missense probably benign
R5500:Recql4 UTSW 15 76,589,778 (GRCm39) intron probably benign
R5547:Recql4 UTSW 15 76,589,994 (GRCm39) nonsense probably null
R5824:Recql4 UTSW 15 76,592,785 (GRCm39) missense probably damaging 1.00
R5976:Recql4 UTSW 15 76,593,624 (GRCm39) missense probably benign 0.01
R6086:Recql4 UTSW 15 76,588,787 (GRCm39) missense probably damaging 0.96
R6756:Recql4 UTSW 15 76,589,059 (GRCm39) missense probably benign 0.00
R7075:Recql4 UTSW 15 76,590,624 (GRCm39) missense possibly damaging 0.95
R7086:Recql4 UTSW 15 76,589,753 (GRCm39) missense unknown
R7449:Recql4 UTSW 15 76,589,765 (GRCm39) missense unknown
R7653:Recql4 UTSW 15 76,587,982 (GRCm39) missense probably benign 0.01
R8314:Recql4 UTSW 15 76,594,380 (GRCm39) missense probably damaging 1.00
R8737:Recql4 UTSW 15 76,593,054 (GRCm39) missense probably benign 0.00
R8789:Recql4 UTSW 15 76,588,546 (GRCm39) missense probably benign
R9093:Recql4 UTSW 15 76,589,685 (GRCm39) missense unknown
V7580:Recql4 UTSW 15 76,590,369 (GRCm39) missense possibly damaging 0.79
V7581:Recql4 UTSW 15 76,590,369 (GRCm39) missense possibly damaging 0.79
V7583:Recql4 UTSW 15 76,590,369 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CAGGGTCTTCACCTGATTGC -3'
(R):5'- GGTATGTATGCCCACCACTAC -3'

Sequencing Primer
(F):5'- GATTGCTGTGCTCCTCATTAGACTG -3'
(R):5'- GCTAGCCAGCTGTTCCC -3'
Posted On 2021-01-18