Incidental Mutation 'R8480:Acvr1b'
ID 657497
Institutional Source Beutler Lab
Gene Symbol Acvr1b
Ensembl Gene ENSMUSG00000000532
Gene Name activin A receptor, type 1B
Synonyms ActRIB, Acvrlk4, SKR2, Alk4, ActR-IB
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 101071953-101111565 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 101108720 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 499 (V499M)
Ref Sequence ENSEMBL: ENSMUSP00000000544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000544]
AlphaFold Q61271
Predicted Effect possibly damaging
Transcript: ENSMUST00000000544
AA Change: V499M

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000000544
Gene: ENSMUSG00000000532
AA Change: V499M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Activin_recp 32 108 4.1e-13 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 177 207 1.89e-14 SMART
Blast:STYKc 209 494 2e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an activin A type IB receptor. Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I and two type II receptors. This protein is a type I receptor which is essential for signaling. Mutations in this gene are associated with pituitary tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010]
PHENOTYPE: Embryos homozygous for targeted mutations that inactivate the gene arrest at the egg cylinder stage, prior to gastrulation, showing epiblast and extraembryonic ectoderm disorganization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 G A 8: 25,294,475 (GRCm39) Q375* probably null Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Aste1 G A 9: 105,274,189 (GRCm39) R143Q possibly damaging Het
Aste1 A T 9: 105,274,995 (GRCm39) T351S probably damaging Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Cdh22 T A 2: 164,988,646 (GRCm39) E236D probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col11a1 A G 3: 113,975,043 (GRCm39) D1234G probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dlec1 G A 9: 118,972,335 (GRCm39) probably null Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm4787 T A 12: 81,424,280 (GRCm39) D626V probably damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Krt36 T C 11: 99,993,635 (GRCm39) D401G possibly damaging Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Lrrc8b A G 5: 105,633,802 (GRCm39) N758S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Or4f14d A T 2: 111,960,330 (GRCm39) D275E possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Recql4 G T 15: 76,588,705 (GRCm39) H1035Q probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sh3d19 T G 3: 85,992,184 (GRCm39) W71G probably benign Het
Sidt1 T C 16: 44,065,529 (GRCm39) Y759C probably damaging Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Ssc5d A T 7: 4,939,328 (GRCm39) D588V probably damaging Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Szt2 A T 4: 118,244,015 (GRCm39) S1363R probably benign Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zfp473 G T 7: 44,382,323 (GRCm39) P670Q probably damaging Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Acvr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:Acvr1b APN 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL03010:Acvr1b APN 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL03011:Acvr1b APN 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL03013:Acvr1b APN 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL03051:Acvr1b APN 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL03127:Acvr1b APN 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL03166:Acvr1b APN 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL03265:Acvr1b APN 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL02980:Acvr1b UTSW 15 101,100,959 (GRCm39) missense probably damaging 0.98
IGL02984:Acvr1b UTSW 15 101,100,959 (GRCm39) missense probably damaging 0.98
R1367:Acvr1b UTSW 15 101,091,819 (GRCm39) missense possibly damaging 0.58
R1498:Acvr1b UTSW 15 101,091,891 (GRCm39) missense probably benign
R1591:Acvr1b UTSW 15 101,091,905 (GRCm39) missense probably benign
R1757:Acvr1b UTSW 15 101,096,703 (GRCm39) missense possibly damaging 0.47
R1793:Acvr1b UTSW 15 101,091,906 (GRCm39) missense probably benign 0.01
R2223:Acvr1b UTSW 15 101,100,924 (GRCm39) missense probably benign 0.10
R2249:Acvr1b UTSW 15 101,100,975 (GRCm39) missense probably null 1.00
R4674:Acvr1b UTSW 15 101,100,939 (GRCm39) missense possibly damaging 0.94
R4676:Acvr1b UTSW 15 101,100,867 (GRCm39) missense probably damaging 1.00
R5151:Acvr1b UTSW 15 101,108,651 (GRCm39) missense probably damaging 1.00
R5223:Acvr1b UTSW 15 101,091,857 (GRCm39) missense probably damaging 1.00
R5397:Acvr1b UTSW 15 101,096,845 (GRCm39) missense probably damaging 0.99
R5574:Acvr1b UTSW 15 101,099,958 (GRCm39) missense probably benign 0.03
R5906:Acvr1b UTSW 15 101,091,772 (GRCm39) intron probably benign
R6025:Acvr1b UTSW 15 101,092,856 (GRCm39) missense probably benign 0.43
R6467:Acvr1b UTSW 15 101,092,722 (GRCm39) missense possibly damaging 0.86
R7158:Acvr1b UTSW 15 101,091,939 (GRCm39) missense probably benign
R9502:Acvr1b UTSW 15 101,092,710 (GRCm39) missense probably benign
X0067:Acvr1b UTSW 15 101,091,903 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGGATCTGACCTGACGAATAGG -3'
(R):5'- TCTGTCTCAAACCCAACGG -3'

Sequencing Primer
(F):5'- AGCGAAGATGAGCCAGTGCC -3'
(R):5'- GGAGTGCGCGTCTCCCAG -3'
Posted On 2021-01-18