Incidental Mutation 'R8480:Acvr1b'
ID 657497
Institutional Source Beutler Lab
Gene Symbol Acvr1b
Ensembl Gene ENSMUSG00000000532
Gene Name activin A receptor, type 1B
Synonyms ActR-IB, ActRIB, Alk4, SKR2, Acvrlk4
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 101174067-101213684 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 101210839 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 499 (V499M)
Ref Sequence ENSEMBL: ENSMUSP00000000544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000544]
AlphaFold Q61271
Predicted Effect possibly damaging
Transcript: ENSMUST00000000544
AA Change: V499M

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000000544
Gene: ENSMUSG00000000532
AA Change: V499M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Activin_recp 32 108 4.1e-13 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 177 207 1.89e-14 SMART
Blast:STYKc 209 494 2e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an activin A type IB receptor. Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I and two type II receptors. This protein is a type I receptor which is essential for signaling. Mutations in this gene are associated with pituitary tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010]
PHENOTYPE: Embryos homozygous for targeted mutations that inactivate the gene arrest at the egg cylinder stage, prior to gastrulation, showing epiblast and extraembryonic ectoderm disorganization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,187,458 P720Q possibly damaging Het
Adam5 G A 8: 24,804,459 Q375* probably null Het
Adgrf1 G A 17: 43,295,164 E60K probably benign Het
Alb T C 5: 90,462,771 V70A probably damaging Het
Aph1b T A 9: 66,788,427 probably benign Het
Aste1 G A 9: 105,396,990 R143Q possibly damaging Het
Aste1 A T 9: 105,397,796 T351S probably damaging Het
Bace2 T A 16: 97,413,470 L286Q probably damaging Het
Bach1 G A 16: 87,719,275 G235R probably damaging Het
Brwd1 A T 16: 96,047,430 H516Q probably damaging Het
Cc2d2a C A 5: 43,685,144 probably null Het
Cdh22 T A 2: 165,146,726 E236D probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Col11a1 A G 3: 114,181,394 D1234G probably benign Het
Cpt2 A G 4: 107,907,760 I269T probably damaging Het
Dcaf7 T A 11: 106,054,793 S323T probably benign Het
Ddias G T 7: 92,859,400 Q436K probably benign Het
Dlec1 G A 9: 119,143,267 probably null Het
Dock5 T A 14: 67,836,410 I294F probably benign Het
Fat2 A T 11: 55,282,968 D2306E possibly damaging Het
Gm4787 T A 12: 81,377,506 D626V probably damaging Het
Gm6563 A G 19: 23,675,926 T27A probably benign Het
Hadhb T C 5: 30,168,570 probably null Het
Hsph1 A T 5: 149,627,564 W406R probably null Het
Ighv1-66 C T 12: 115,593,382 G27R possibly damaging Het
Impad1 C T 4: 4,769,376 M246I probably benign Het
Krt26 T C 11: 99,337,600 E102G probably damaging Het
Krt34 T A 11: 100,040,145 probably null Het
Krt36 T C 11: 100,102,809 D401G possibly damaging Het
Loxhd1 G A 18: 77,431,131 G326S probably damaging Het
Lrrc8b A G 5: 105,485,936 N758S probably damaging Het
Mkl2 A T 16: 13,384,192 probably null Het
Muc4 C T 16: 32,752,993 T957I probably benign Het
Naip5 T C 13: 100,222,235 Y831C probably damaging Het
Nfatc1 A T 18: 80,635,644 V829E probably benign Het
Nmnat1 G A 4: 149,473,370 L72F possibly damaging Het
Olfr1316 A T 2: 112,129,985 D275E possibly damaging Het
Pcdh7 T A 5: 58,129,065 V1161E probably damaging Het
Raver1 A G 9: 21,090,280 Y86H probably benign Het
Recql4 G T 15: 76,704,505 H1035Q probably benign Het
Sgsm1 A T 5: 113,263,418 M814K probably benign Het
Sh3d19 T G 3: 86,084,877 W71G probably benign Het
Sidt1 T C 16: 44,245,166 Y759C probably damaging Het
Spg11 G T 2: 122,113,079 D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Ssc5d A T 7: 4,936,329 D588V probably damaging Het
Supt20 C A 3: 54,707,116 T181K probably damaging Het
Szt2 A T 4: 118,386,818 S1363R probably benign Het
Tbcel G A 9: 42,463,873 probably null Het
Ube2e3 T C 2: 78,918,814 L169P probably damaging Het
Wrn A G 8: 33,288,768 F595S probably benign Het
Zfp473 G T 7: 44,732,899 P670Q probably damaging Het
Zw10 C T 9: 49,074,999 A660V probably benign Het
Other mutations in Acvr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03010:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03011:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03013:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03051:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03127:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03166:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03265:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL02980:Acvr1b UTSW 15 101203078 missense probably damaging 0.98
IGL02984:Acvr1b UTSW 15 101203078 missense probably damaging 0.98
R1367:Acvr1b UTSW 15 101193938 missense possibly damaging 0.58
R1498:Acvr1b UTSW 15 101194010 missense probably benign
R1591:Acvr1b UTSW 15 101194024 missense probably benign
R1757:Acvr1b UTSW 15 101198822 missense possibly damaging 0.47
R1793:Acvr1b UTSW 15 101194025 missense probably benign 0.01
R2223:Acvr1b UTSW 15 101203043 missense probably benign 0.10
R2249:Acvr1b UTSW 15 101203094 missense probably null 1.00
R4674:Acvr1b UTSW 15 101203058 missense possibly damaging 0.94
R4676:Acvr1b UTSW 15 101202986 missense probably damaging 1.00
R5151:Acvr1b UTSW 15 101210770 missense probably damaging 1.00
R5223:Acvr1b UTSW 15 101193976 missense probably damaging 1.00
R5397:Acvr1b UTSW 15 101198964 missense probably damaging 0.99
R5574:Acvr1b UTSW 15 101202077 missense probably benign 0.03
R5906:Acvr1b UTSW 15 101193891 intron probably benign
R6025:Acvr1b UTSW 15 101194975 missense probably benign 0.43
R6467:Acvr1b UTSW 15 101194841 missense possibly damaging 0.86
R7158:Acvr1b UTSW 15 101194058 missense probably benign
R9502:Acvr1b UTSW 15 101194829 missense probably benign
X0067:Acvr1b UTSW 15 101194022 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGGATCTGACCTGACGAATAGG -3'
(R):5'- TCTGTCTCAAACCCAACGG -3'

Sequencing Primer
(F):5'- AGCGAAGATGAGCCAGTGCC -3'
(R):5'- GGAGTGCGCGTCTCCCAG -3'
Posted On 2021-01-18