Mutagenetix > Incidental Mutation

Incidental Mutation 'R8480:Mkl2'

657498

Institutional Source

Beutler Lab

Gene Symbol

Mkl2

Ensembl Gene

ENSMUSG00000009569

Gene Name

MKL/myocardin-like 2

Synonyms

Gt4-1, MRTF-B, Mrtfb

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8480 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13256481-13417529 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 13384192 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009713] [ENSMUST00000009713] [ENSMUST00000149359] [ENSMUST00000149359]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000009713

SMART Domains

Protein: ENSMUSP00000009713
Gene: ENSMUSG00000009569

Domain	Start	End	E-Value	Type
RPEL	51	76	9.67e-5	SMART
RPEL	95	120	2.22e-4	SMART
RPEL	139	164	1.56e-8	SMART
low complexity region	217	230	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
low complexity region	329	352	N/A	INTRINSIC
low complexity region	369	381	N/A	INTRINSIC
SAP	394	428	1.29e-8	SMART
low complexity region	495	510	N/A	INTRINSIC
coiled coil region	552	601	N/A	INTRINSIC
low complexity region	603	617	N/A	INTRINSIC
low complexity region	699	722	N/A	INTRINSIC
low complexity region	749	775	N/A	INTRINSIC
low complexity region	842	854	N/A	INTRINSIC
low complexity region	1039	1050	N/A	INTRINSIC
low complexity region	1057	1074	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000009713

SMART Domains

Protein: ENSMUSP00000009713
Gene: ENSMUSG00000009569

Domain	Start	End	E-Value	Type
RPEL	51	76	9.67e-5	SMART
RPEL	95	120	2.22e-4	SMART
RPEL	139	164	1.56e-8	SMART
low complexity region	217	230	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
low complexity region	329	352	N/A	INTRINSIC
low complexity region	369	381	N/A	INTRINSIC
SAP	394	428	1.29e-8	SMART
low complexity region	495	510	N/A	INTRINSIC
coiled coil region	552	601	N/A	INTRINSIC
low complexity region	603	617	N/A	INTRINSIC
low complexity region	699	722	N/A	INTRINSIC
low complexity region	749	775	N/A	INTRINSIC
low complexity region	842	854	N/A	INTRINSIC
low complexity region	1039	1050	N/A	INTRINSIC
low complexity region	1057	1074	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000149359

SMART Domains

Protein: ENSMUSP00000122815
Gene: ENSMUSG00000009569

Domain	Start	End	E-Value	Type
RPEL	40	65	4.51e-5	SMART
RPEL	84	109	2.22e-4	SMART
RPEL	128	153	1.56e-8	SMART
low complexity region	206	219	N/A	INTRINSIC
low complexity region	280	293	N/A	INTRINSIC
low complexity region	318	341	N/A	INTRINSIC
low complexity region	358	370	N/A	INTRINSIC
SAP	383	417	1.29e-8	SMART
low complexity region	484	499	N/A	INTRINSIC
coiled coil region	541	590	N/A	INTRINSIC
low complexity region	592	606	N/A	INTRINSIC
low complexity region	688	711	N/A	INTRINSIC
low complexity region	738	764	N/A	INTRINSIC
low complexity region	831	843	N/A	INTRINSIC
low complexity region	1028	1039	N/A	INTRINSIC
low complexity region	1046	1063	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000149359

SMART Domains

Protein: ENSMUSP00000122815
Gene: ENSMUSG00000009569

Domain	Start	End	E-Value	Type
RPEL	40	65	4.51e-5	SMART
RPEL	84	109	2.22e-4	SMART
RPEL	128	153	1.56e-8	SMART
low complexity region	206	219	N/A	INTRINSIC
low complexity region	280	293	N/A	INTRINSIC
low complexity region	318	341	N/A	INTRINSIC
low complexity region	358	370	N/A	INTRINSIC
SAP	383	417	1.29e-8	SMART
low complexity region	484	499	N/A	INTRINSIC
coiled coil region	541	590	N/A	INTRINSIC
low complexity region	592	606	N/A	INTRINSIC
low complexity region	688	711	N/A	INTRINSIC
low complexity region	738	764	N/A	INTRINSIC
low complexity region	831	843	N/A	INTRINSIC
low complexity region	1028	1039	N/A	INTRINSIC
low complexity region	1046	1063	N/A	INTRINSIC

Meta Mutation Damage Score

0.9496

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (53/54)

MGI Phenotype

PHENOTYPE: Mice homozygous for knock-out alleles exhibit prenatal lethality with widespread hemorrhaging, cardiovascular defects, and craniofacial anomalies. Mice homozygous for a gene trap allele exhibit fetal lethality due to cardiac outflow tractdefects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,187,458	P720Q	possibly damaging	Het
Acvr1b	G	A	15: 101,210,839	V499M	possibly damaging	Het
Adam5	G	A	8: 24,804,459	Q375*	probably null	Het
Adgrf1	G	A	17: 43,295,164	E60K	probably benign	Het
Alb	T	C	5: 90,462,771	V70A	probably damaging	Het
Aph1b	T	A	9: 66,788,427		probably benign	Het
Aste1	G	A	9: 105,396,990	R143Q	possibly damaging	Het
Aste1	A	T	9: 105,397,796	T351S	probably damaging	Het
Bace2	T	A	16: 97,413,470	L286Q	probably damaging	Het
Bach1	G	A	16: 87,719,275	G235R	probably damaging	Het
Brwd1	A	T	16: 96,047,430	H516Q	probably damaging	Het
Cc2d2a	C	A	5: 43,685,144		probably null	Het
Cdh22	T	A	2: 165,146,726	E236D	probably benign	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Celsr2	T	A	3: 108,398,902	T2029S	probably benign	Het
Col11a1	A	G	3: 114,181,394	D1234G	probably benign	Het
Cpt2	A	G	4: 107,907,760	I269T	probably damaging	Het
Dcaf7	T	A	11: 106,054,793	S323T	probably benign	Het
Ddias	G	T	7: 92,859,400	Q436K	probably benign	Het
Dlec1	G	A	9: 119,143,267		probably null	Het
Dock5	T	A	14: 67,836,410	I294F	probably benign	Het
Fat2	A	T	11: 55,282,968	D2306E	possibly damaging	Het
Gm4787	T	A	12: 81,377,506	D626V	probably damaging	Het
Gm6563	A	G	19: 23,675,926	T27A	probably benign	Het
Hadhb	T	C	5: 30,168,570		probably null	Het
Hsph1	A	T	5: 149,627,564	W406R	probably null	Het
Ighv1-66	C	T	12: 115,593,382	G27R	possibly damaging	Het
Impad1	C	T	4: 4,769,376	M246I	probably benign	Het
Krt26	T	C	11: 99,337,600	E102G	probably damaging	Het
Krt34	T	A	11: 100,040,145		probably null	Het
Krt36	T	C	11: 100,102,809	D401G	possibly damaging	Het
Loxhd1	G	A	18: 77,431,131	G326S	probably damaging	Het
Lrrc8b	A	G	5: 105,485,936	N758S	probably damaging	Het
Muc4	C	T	16: 32,752,993	T957I	probably benign	Het
Naip5	T	C	13: 100,222,235	Y831C	probably damaging	Het
Nfatc1	A	T	18: 80,635,644	V829E	probably benign	Het
Nmnat1	G	A	4: 149,473,370	L72F	possibly damaging	Het
Olfr1316	A	T	2: 112,129,985	D275E	possibly damaging	Het
Pcdh7	T	A	5: 58,129,065	V1161E	probably damaging	Het
Raver1	A	G	9: 21,090,280	Y86H	probably benign	Het
Recql4	G	T	15: 76,704,505	H1035Q	probably benign	Het
Sgsm1	A	T	5: 113,263,418	M814K	probably benign	Het
Sh3d19	T	G	3: 86,084,877	W71G	probably benign	Het
Sidt1	T	C	16: 44,245,166	Y759C	probably damaging	Het
Spg11	G	T	2: 122,113,079	D197E	probably damaging	Het
Sppl2b	TGTCACAGGT	TGT	10: 80,866,069		probably null	Het
Ssc5d	A	T	7: 4,936,329	D588V	probably damaging	Het
Supt20	C	A	3: 54,707,116	T181K	probably damaging	Het
Szt2	A	T	4: 118,386,818	S1363R	probably benign	Het
Tbcel	G	A	9: 42,463,873		probably null	Het
Ube2e3	T	C	2: 78,918,814	L169P	probably damaging	Het
Wrn	A	G	8: 33,288,768	F595S	probably benign	Het
Zfp473	G	T	7: 44,732,899	P670Q	probably damaging	Het
Zw10	C	T	9: 49,074,999	A660V	probably benign	Het

Other mutations in Mkl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Mkl2	APN	16	13403222	missense	probably benign	0.28
IGL00546:Mkl2	APN	16	13403225	missense	possibly damaging	0.71
IGL01325:Mkl2	APN	16	13401224	missense	probably damaging	1.00
IGL02125:Mkl2	APN	16	13400183	splice site	probably null
IGL02803:Mkl2	APN	16	13403156	missense	possibly damaging	0.94
IGL03143:Mkl2	APN	16	13400812	missense	possibly damaging	0.46
IGL03180:Mkl2	APN	16	13398332	missense	probably damaging	1.00
R0281:Mkl2	UTSW	16	13412163	missense	probably damaging	0.99
R0505:Mkl2	UTSW	16	13412526	missense	possibly damaging	0.80
R0540:Mkl2	UTSW	16	13381601	missense	probably damaging	1.00
R0607:Mkl2	UTSW	16	13381601	missense	probably damaging	1.00
R1073:Mkl2	UTSW	16	13412318	missense	possibly damaging	0.89
R1423:Mkl2	UTSW	16	13412241	missense	possibly damaging	0.96
R1432:Mkl2	UTSW	16	13401002	missense	probably benign	0.01
R1459:Mkl2	UTSW	16	13401569	missense	possibly damaging	0.93
R1693:Mkl2	UTSW	16	13398470	missense	possibly damaging	0.67
R1693:Mkl2	UTSW	16	13398471	missense	probably damaging	0.99
R2006:Mkl2	UTSW	16	13381576	nonsense	probably null
R2076:Mkl2	UTSW	16	13401382	missense	probably benign	0.01
R2125:Mkl2	UTSW	16	13400804	missense	possibly damaging	0.94
R2145:Mkl2	UTSW	16	13412586	missense	probably damaging	0.98
R3722:Mkl2	UTSW	16	13385693	missense	probably damaging	1.00
R3883:Mkl2	UTSW	16	13401458	missense	probably damaging	0.99
R4088:Mkl2	UTSW	16	13384200	missense	probably damaging	0.98
R4204:Mkl2	UTSW	16	13403255	missense	possibly damaging	0.88
R4301:Mkl2	UTSW	16	13398305	missense	probably damaging	1.00
R4622:Mkl2	UTSW	16	13332706	missense	probably damaging	1.00
R4633:Mkl2	UTSW	16	13379873	missense	possibly damaging	0.95
R4765:Mkl2	UTSW	16	13412594	missense	probably damaging	1.00
R5201:Mkl2	UTSW	16	13401592	missense	probably benign	0.00
R5403:Mkl2	UTSW	16	13401013	missense	probably damaging	0.97
R5725:Mkl2	UTSW	16	13384310	nonsense	probably null
R6511:Mkl2	UTSW	16	13379850	missense	probably damaging	1.00
R7207:Mkl2	UTSW	16	13326436	missense	probably benign
R7269:Mkl2	UTSW	16	13401034	missense	possibly damaging	0.48
R7311:Mkl2	UTSW	16	13405854	nonsense	probably null
R7460:Mkl2	UTSW	16	13400976	missense	probably benign	0.00
R9032:Mkl2	UTSW	16	13412228	missense	probably damaging	1.00
R9085:Mkl2	UTSW	16	13412228	missense	probably damaging	1.00
R9098:Mkl2	UTSW	16	13403189	missense	probably benign
R9229:Mkl2	UTSW	16	13412321	missense	possibly damaging	0.89
R9298:Mkl2	UTSW	16	13384218	missense	probably benign	0.10
R9310:Mkl2	UTSW	16	13401090	missense	probably benign
R9343:Mkl2	UTSW	16	13400927	missense	probably benign	0.00
R9436:Mkl2	UTSW	16	13405287	nonsense	probably null
Z1177:Mkl2	UTSW	16	13385606	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGTGTTCTAACAAATCTGACCTCC -3'
(R):5'- TTCTCCCAGAAGACTGAGGC -3'

Sequencing Primer
(F):5'- TCCTCCTGTAGGCACTGATGG -3'
(R):5'- GACTGAGGCTAGAACTCTTGC -3'

Posted On

2021-01-18