Incidental Mutation 'R8480:Sidt1'
ID 657500
Institutional Source Beutler Lab
Gene Symbol Sidt1
Ensembl Gene ENSMUSG00000022696
Gene Name SID1 transmembrane family, member 1
Synonyms B830021E24Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8480 (G1)
Quality Score 209.009
Status Validated
Chromosome 16
Chromosomal Location 44240180-44333196 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44245166 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 759 (Y759C)
Ref Sequence ENSEMBL: ENSMUSP00000115372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047446] [ENSMUST00000136381]
AlphaFold Q6AXF6
Predicted Effect probably damaging
Transcript: ENSMUST00000047446
AA Change: Y764C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038433
Gene: ENSMUSG00000022696
AA Change: Y764C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
Pfam:SID-1_RNA_chan 184 832 1.8e-290 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136381
AA Change: Y759C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115372
Gene: ENSMUSG00000022696
AA Change: Y759C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
Pfam:SID-1_RNA_chan 184 827 1.3e-251 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,187,458 P720Q possibly damaging Het
Acvr1b G A 15: 101,210,839 V499M possibly damaging Het
Adam5 G A 8: 24,804,459 Q375* probably null Het
Adgrf1 G A 17: 43,295,164 E60K probably benign Het
Alb T C 5: 90,462,771 V70A probably damaging Het
Aph1b T A 9: 66,788,427 probably benign Het
Aste1 G A 9: 105,396,990 R143Q possibly damaging Het
Aste1 A T 9: 105,397,796 T351S probably damaging Het
Bace2 T A 16: 97,413,470 L286Q probably damaging Het
Bach1 G A 16: 87,719,275 G235R probably damaging Het
Brwd1 A T 16: 96,047,430 H516Q probably damaging Het
Cc2d2a C A 5: 43,685,144 probably null Het
Cdh22 T A 2: 165,146,726 E236D probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Col11a1 A G 3: 114,181,394 D1234G probably benign Het
Cpt2 A G 4: 107,907,760 I269T probably damaging Het
Dcaf7 T A 11: 106,054,793 S323T probably benign Het
Ddias G T 7: 92,859,400 Q436K probably benign Het
Dlec1 G A 9: 119,143,267 probably null Het
Dock5 T A 14: 67,836,410 I294F probably benign Het
Fat2 A T 11: 55,282,968 D2306E possibly damaging Het
Gm4787 T A 12: 81,377,506 D626V probably damaging Het
Gm6563 A G 19: 23,675,926 T27A probably benign Het
Hadhb T C 5: 30,168,570 probably null Het
Hsph1 A T 5: 149,627,564 W406R probably null Het
Ighv1-66 C T 12: 115,593,382 G27R possibly damaging Het
Impad1 C T 4: 4,769,376 M246I probably benign Het
Krt26 T C 11: 99,337,600 E102G probably damaging Het
Krt34 T A 11: 100,040,145 probably null Het
Krt36 T C 11: 100,102,809 D401G possibly damaging Het
Loxhd1 G A 18: 77,431,131 G326S probably damaging Het
Lrrc8b A G 5: 105,485,936 N758S probably damaging Het
Mkl2 A T 16: 13,384,192 probably null Het
Muc4 C T 16: 32,752,993 T957I probably benign Het
Naip5 T C 13: 100,222,235 Y831C probably damaging Het
Nfatc1 A T 18: 80,635,644 V829E probably benign Het
Nmnat1 G A 4: 149,473,370 L72F possibly damaging Het
Olfr1316 A T 2: 112,129,985 D275E possibly damaging Het
Pcdh7 T A 5: 58,129,065 V1161E probably damaging Het
Raver1 A G 9: 21,090,280 Y86H probably benign Het
Recql4 G T 15: 76,704,505 H1035Q probably benign Het
Sgsm1 A T 5: 113,263,418 M814K probably benign Het
Sh3d19 T G 3: 86,084,877 W71G probably benign Het
Spg11 G T 2: 122,113,079 D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Ssc5d A T 7: 4,936,329 D588V probably damaging Het
Supt20 C A 3: 54,707,116 T181K probably damaging Het
Szt2 A T 4: 118,386,818 S1363R probably benign Het
Tbcel G A 9: 42,463,873 probably null Het
Ube2e3 T C 2: 78,918,814 L169P probably damaging Het
Wrn A G 8: 33,288,768 F595S probably benign Het
Zfp473 G T 7: 44,732,899 P670Q probably damaging Het
Zw10 C T 9: 49,074,999 A660V probably benign Het
Other mutations in Sidt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00709:Sidt1 APN 16 44262011 splice site probably benign
IGL01103:Sidt1 APN 16 44243543 nonsense probably null
IGL01725:Sidt1 APN 16 44284282 missense probably benign 0.06
IGL02000:Sidt1 APN 16 44286369 missense probably damaging 0.98
IGL02266:Sidt1 APN 16 44254985 missense possibly damaging 0.90
IGL02309:Sidt1 APN 16 44254980 missense probably benign 0.00
IGL02898:Sidt1 APN 16 44282495 missense possibly damaging 0.87
R0282:Sidt1 UTSW 16 44281886 missense possibly damaging 0.79
R0525:Sidt1 UTSW 16 44259446 missense possibly damaging 0.64
R0927:Sidt1 UTSW 16 44243532 missense probably benign 0.00
R1806:Sidt1 UTSW 16 44281871 missense possibly damaging 0.46
R1911:Sidt1 UTSW 16 44281871 missense possibly damaging 0.81
R3843:Sidt1 UTSW 16 44284224 missense probably benign 0.04
R3848:Sidt1 UTSW 16 44255959 intron probably benign
R4023:Sidt1 UTSW 16 44281886 missense possibly damaging 0.79
R4026:Sidt1 UTSW 16 44281886 missense possibly damaging 0.79
R4495:Sidt1 UTSW 16 44282478 missense probably damaging 1.00
R4603:Sidt1 UTSW 16 44255026 missense probably damaging 0.98
R4707:Sidt1 UTSW 16 44269858 nonsense probably null
R5322:Sidt1 UTSW 16 44281622 intron probably benign
R5921:Sidt1 UTSW 16 44273735 splice site probably benign
R5980:Sidt1 UTSW 16 44263312 nonsense probably null
R5982:Sidt1 UTSW 16 44261708 missense probably damaging 1.00
R6063:Sidt1 UTSW 16 44259466 missense probably benign 0.01
R6337:Sidt1 UTSW 16 44300935 splice site probably null
R6392:Sidt1 UTSW 16 44291294 missense possibly damaging 0.47
R6855:Sidt1 UTSW 16 44245343 missense probably null 1.00
R7092:Sidt1 UTSW 16 44299829 missense possibly damaging 0.89
R7099:Sidt1 UTSW 16 44243497 missense probably damaging 1.00
R7448:Sidt1 UTSW 16 44286400 nonsense probably null
R7574:Sidt1 UTSW 16 44259485 missense probably damaging 1.00
R8265:Sidt1 UTSW 16 44267887 missense possibly damaging 0.79
R8379:Sidt1 UTSW 16 44286392 missense probably benign 0.14
R8460:Sidt1 UTSW 16 44287342 nonsense probably null
R8762:Sidt1 UTSW 16 44332344 missense probably benign 0.16
R8954:Sidt1 UTSW 16 44262027 missense probably benign 0.04
R8974:Sidt1 UTSW 16 44281617 makesense probably null
R9362:Sidt1 UTSW 16 44257953 missense possibly damaging 0.96
R9451:Sidt1 UTSW 16 44255029 critical splice acceptor site probably null
R9669:Sidt1 UTSW 16 44281880 missense probably damaging 1.00
R9737:Sidt1 UTSW 16 44281880 missense probably damaging 1.00
Z1176:Sidt1 UTSW 16 44259482 missense possibly damaging 0.90
Z1191:Sidt1 UTSW 16 44257931 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTGACTAAGTGTGCTCATTAAAC -3'
(R):5'- ATCATGAAGGTGAGCACTCGTG -3'

Sequencing Primer
(F):5'- GGCATGATGAAGCAAGAACTG -3'
(R):5'- TCGTGCGCGAGGAGCTG -3'
Posted On 2021-01-18