Incidental Mutation 'R8480:Sidt1'
ID 657500
Institutional Source Beutler Lab
Gene Symbol Sidt1
Ensembl Gene ENSMUSG00000022696
Gene Name SID1 transmembrane family, member 1
Synonyms B830021E24Rik
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8480 (G1)
Quality Score 209.009
Status Validated
Chromosome 16
Chromosomal Location 44060543-44153559 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44065529 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 759 (Y759C)
Ref Sequence ENSEMBL: ENSMUSP00000115372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047446] [ENSMUST00000136381]
AlphaFold Q6AXF6
Predicted Effect probably damaging
Transcript: ENSMUST00000047446
AA Change: Y764C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038433
Gene: ENSMUSG00000022696
AA Change: Y764C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
Pfam:SID-1_RNA_chan 184 832 1.8e-290 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136381
AA Change: Y759C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115372
Gene: ENSMUSG00000022696
AA Change: Y759C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
Pfam:SID-1_RNA_chan 184 827 1.3e-251 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b G A 15: 101,108,720 (GRCm39) V499M possibly damaging Het
Adam5 G A 8: 25,294,475 (GRCm39) Q375* probably null Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Aste1 G A 9: 105,274,189 (GRCm39) R143Q possibly damaging Het
Aste1 A T 9: 105,274,995 (GRCm39) T351S probably damaging Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Cdh22 T A 2: 164,988,646 (GRCm39) E236D probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col11a1 A G 3: 113,975,043 (GRCm39) D1234G probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dlec1 G A 9: 118,972,335 (GRCm39) probably null Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm4787 T A 12: 81,424,280 (GRCm39) D626V probably damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Krt36 T C 11: 99,993,635 (GRCm39) D401G possibly damaging Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Lrrc8b A G 5: 105,633,802 (GRCm39) N758S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Or4f14d A T 2: 111,960,330 (GRCm39) D275E possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Recql4 G T 15: 76,588,705 (GRCm39) H1035Q probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sh3d19 T G 3: 85,992,184 (GRCm39) W71G probably benign Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Ssc5d A T 7: 4,939,328 (GRCm39) D588V probably damaging Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Szt2 A T 4: 118,244,015 (GRCm39) S1363R probably benign Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zfp473 G T 7: 44,382,323 (GRCm39) P670Q probably damaging Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Sidt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00709:Sidt1 APN 16 44,082,374 (GRCm39) splice site probably benign
IGL01103:Sidt1 APN 16 44,063,906 (GRCm39) nonsense probably null
IGL01725:Sidt1 APN 16 44,104,645 (GRCm39) missense probably benign 0.06
IGL02000:Sidt1 APN 16 44,106,732 (GRCm39) missense probably damaging 0.98
IGL02266:Sidt1 APN 16 44,075,348 (GRCm39) missense possibly damaging 0.90
IGL02309:Sidt1 APN 16 44,075,343 (GRCm39) missense probably benign 0.00
IGL02898:Sidt1 APN 16 44,102,858 (GRCm39) missense possibly damaging 0.87
R0282:Sidt1 UTSW 16 44,102,249 (GRCm39) missense possibly damaging 0.79
R0525:Sidt1 UTSW 16 44,079,809 (GRCm39) missense possibly damaging 0.64
R0927:Sidt1 UTSW 16 44,063,895 (GRCm39) missense probably benign 0.00
R1806:Sidt1 UTSW 16 44,102,234 (GRCm39) missense possibly damaging 0.46
R1911:Sidt1 UTSW 16 44,102,234 (GRCm39) missense possibly damaging 0.81
R3843:Sidt1 UTSW 16 44,104,587 (GRCm39) missense probably benign 0.04
R3848:Sidt1 UTSW 16 44,076,322 (GRCm39) intron probably benign
R4023:Sidt1 UTSW 16 44,102,249 (GRCm39) missense possibly damaging 0.79
R4026:Sidt1 UTSW 16 44,102,249 (GRCm39) missense possibly damaging 0.79
R4495:Sidt1 UTSW 16 44,102,841 (GRCm39) missense probably damaging 1.00
R4603:Sidt1 UTSW 16 44,075,389 (GRCm39) missense probably damaging 0.98
R4707:Sidt1 UTSW 16 44,090,221 (GRCm39) nonsense probably null
R5322:Sidt1 UTSW 16 44,101,985 (GRCm39) intron probably benign
R5921:Sidt1 UTSW 16 44,094,098 (GRCm39) splice site probably benign
R5980:Sidt1 UTSW 16 44,083,675 (GRCm39) nonsense probably null
R5982:Sidt1 UTSW 16 44,082,071 (GRCm39) missense probably damaging 1.00
R6063:Sidt1 UTSW 16 44,079,829 (GRCm39) missense probably benign 0.01
R6337:Sidt1 UTSW 16 44,121,298 (GRCm39) splice site probably null
R6392:Sidt1 UTSW 16 44,111,657 (GRCm39) missense possibly damaging 0.47
R6855:Sidt1 UTSW 16 44,065,706 (GRCm39) missense probably null 1.00
R7092:Sidt1 UTSW 16 44,120,192 (GRCm39) missense possibly damaging 0.89
R7099:Sidt1 UTSW 16 44,063,860 (GRCm39) missense probably damaging 1.00
R7448:Sidt1 UTSW 16 44,106,763 (GRCm39) nonsense probably null
R7574:Sidt1 UTSW 16 44,079,848 (GRCm39) missense probably damaging 1.00
R8265:Sidt1 UTSW 16 44,088,250 (GRCm39) missense possibly damaging 0.79
R8379:Sidt1 UTSW 16 44,106,755 (GRCm39) missense probably benign 0.14
R8460:Sidt1 UTSW 16 44,107,705 (GRCm39) nonsense probably null
R8762:Sidt1 UTSW 16 44,152,707 (GRCm39) missense probably benign 0.16
R8954:Sidt1 UTSW 16 44,082,390 (GRCm39) missense probably benign 0.04
R8974:Sidt1 UTSW 16 44,101,980 (GRCm39) makesense probably null
R9362:Sidt1 UTSW 16 44,078,316 (GRCm39) missense possibly damaging 0.96
R9451:Sidt1 UTSW 16 44,075,392 (GRCm39) critical splice acceptor site probably null
R9669:Sidt1 UTSW 16 44,102,243 (GRCm39) missense probably damaging 1.00
R9737:Sidt1 UTSW 16 44,102,243 (GRCm39) missense probably damaging 1.00
Z1176:Sidt1 UTSW 16 44,079,845 (GRCm39) missense possibly damaging 0.90
Z1191:Sidt1 UTSW 16 44,078,294 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTGACTAAGTGTGCTCATTAAAC -3'
(R):5'- ATCATGAAGGTGAGCACTCGTG -3'

Sequencing Primer
(F):5'- GGCATGATGAAGCAAGAACTG -3'
(R):5'- TCGTGCGCGAGGAGCTG -3'
Posted On 2021-01-18