Mutagenetix > Incidental Mutation

Incidental Mutation 'R8480:Loxhd1'

657505

Institutional Source

Beutler Lab

Gene Symbol

Loxhd1

Ensembl Gene

ENSMUSG00000032818

Gene Name

lipoxygenase homology domains 1

Synonyms

sba, 1700096C21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.269) question?

Stock #

R8480 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77281958-77442341 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 77431131 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 326 (G326S)

Ref Sequence

ENSEMBL: ENSMUSP00000116287 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096547] [ENSMUST00000123166] [ENSMUST00000123410]

AlphaFold

C8YR32

Predicted Effect

probably damaging
Transcript: ENSMUST00000096547
AA Change: G1878S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: G1878S

Domain	Start	End	E-Value	Type
LH2	43	158	5.64e-5	SMART
LH2	172	290	1.64e-9	SMART
LH2	296	409	1.1e-4	SMART
LH2	425	539	4.02e-4	SMART
LH2	553	675	3.79e-6	SMART
LH2	684	800	5.92e-6	SMART
LH2	814	936	6.91e-8	SMART
low complexity region	945	954	N/A	INTRINSIC
LH2	970	1086	4.81e-7	SMART
LH2	1101	1228	5.73e-3	SMART
LH2	1255	1375	8.82e-5	SMART
Pfam:PLAT	1424	1540	5.4e-10	PFAM
LH2	1553	1666	6.41e-3	SMART
LH2	1680	1799	6.76e-6	SMART
Pfam:PLAT	1813	1929	3.8e-9	PFAM
LH2	1949	2067	7.23e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000123166
AA Change: G326S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116287
Gene: ENSMUSG00000032818
AA Change: G326S

Domain	Start	End	E-Value	Type
LH2	1	114	6.41e-3	SMART
LH2	128	247	6.76e-6	SMART
Pfam:PLAT	261	379	1.3e-8	PFAM
LH2	397	515	7.23e-11	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000123410
AA Change: G1012S

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000120991
Gene: ENSMUSG00000032818
AA Change: G1012S

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	67	4.4e-15	PFAM
low complexity region	79	88	N/A	INTRINSIC
LH2	104	220	4.81e-7	SMART
LH2	235	362	5.73e-3	SMART
LH2	389	509	8.82e-5	SMART
Pfam:PLAT	558	674	9.9e-12	PFAM
LH2	687	800	6.41e-3	SMART
LH2	814	933	6.76e-6	SMART
Pfam:PLAT	947	1065	8.8e-9	PFAM
Pfam:PLAT	1085	1174	4.2e-11	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (53/54)

MGI Phenotype

PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,187,458	P720Q	possibly damaging	Het
Acvr1b	G	A	15: 101,210,839	V499M	possibly damaging	Het
Adam5	G	A	8: 24,804,459	Q375*	probably null	Het
Adgrf1	G	A	17: 43,295,164	E60K	probably benign	Het
Alb	T	C	5: 90,462,771	V70A	probably damaging	Het
Aph1b	T	A	9: 66,788,427		probably benign	Het
Aste1	G	A	9: 105,396,990	R143Q	possibly damaging	Het
Aste1	A	T	9: 105,397,796	T351S	probably damaging	Het
Bace2	T	A	16: 97,413,470	L286Q	probably damaging	Het
Bach1	G	A	16: 87,719,275	G235R	probably damaging	Het
Brwd1	A	T	16: 96,047,430	H516Q	probably damaging	Het
Cc2d2a	C	A	5: 43,685,144		probably null	Het
Cdh22	T	A	2: 165,146,726	E236D	probably benign	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Celsr2	T	A	3: 108,398,902	T2029S	probably benign	Het
Col11a1	A	G	3: 114,181,394	D1234G	probably benign	Het
Cpt2	A	G	4: 107,907,760	I269T	probably damaging	Het
Dcaf7	T	A	11: 106,054,793	S323T	probably benign	Het
Ddias	G	T	7: 92,859,400	Q436K	probably benign	Het
Dlec1	G	A	9: 119,143,267		probably null	Het
Dock5	T	A	14: 67,836,410	I294F	probably benign	Het
Fat2	A	T	11: 55,282,968	D2306E	possibly damaging	Het
Gm4787	T	A	12: 81,377,506	D626V	probably damaging	Het
Gm6563	A	G	19: 23,675,926	T27A	probably benign	Het
Hadhb	T	C	5: 30,168,570		probably null	Het
Hsph1	A	T	5: 149,627,564	W406R	probably null	Het
Ighv1-66	C	T	12: 115,593,382	G27R	possibly damaging	Het
Impad1	C	T	4: 4,769,376	M246I	probably benign	Het
Krt26	T	C	11: 99,337,600	E102G	probably damaging	Het
Krt34	T	A	11: 100,040,145		probably null	Het
Krt36	T	C	11: 100,102,809	D401G	possibly damaging	Het
Lrrc8b	A	G	5: 105,485,936	N758S	probably damaging	Het
Mkl2	A	T	16: 13,384,192		probably null	Het
Muc4	C	T	16: 32,752,993	T957I	probably benign	Het
Naip5	T	C	13: 100,222,235	Y831C	probably damaging	Het
Nfatc1	A	T	18: 80,635,644	V829E	probably benign	Het
Nmnat1	G	A	4: 149,473,370	L72F	possibly damaging	Het
Olfr1316	A	T	2: 112,129,985	D275E	possibly damaging	Het
Pcdh7	T	A	5: 58,129,065	V1161E	probably damaging	Het
Raver1	A	G	9: 21,090,280	Y86H	probably benign	Het
Recql4	G	T	15: 76,704,505	H1035Q	probably benign	Het
Sgsm1	A	T	5: 113,263,418	M814K	probably benign	Het
Sh3d19	T	G	3: 86,084,877	W71G	probably benign	Het
Sidt1	T	C	16: 44,245,166	Y759C	probably damaging	Het
Spg11	G	T	2: 122,113,079	D197E	probably damaging	Het
Sppl2b	TGTCACAGGT	TGT	10: 80,866,069		probably null	Het
Ssc5d	A	T	7: 4,936,329	D588V	probably damaging	Het
Supt20	C	A	3: 54,707,116	T181K	probably damaging	Het
Szt2	A	T	4: 118,386,818	S1363R	probably benign	Het
Tbcel	G	A	9: 42,463,873		probably null	Het
Ube2e3	T	C	2: 78,918,814	L169P	probably damaging	Het
Wrn	A	G	8: 33,288,768	F595S	probably benign	Het
Zfp473	G	T	7: 44,732,899	P670Q	probably damaging	Het
Zw10	C	T	9: 49,074,999	A660V	probably benign	Het

Other mutations in Loxhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Loxhd1	APN	18	77395450	missense	probably damaging	0.99
IGL00490:Loxhd1	APN	18	77431074	missense	possibly damaging	0.94
IGL00507:Loxhd1	APN	18	77332567	missense	probably benign	0.03
IGL00546:Loxhd1	APN	18	77405976	missense	probably damaging	0.97
IGL01369:Loxhd1	APN	18	77329201	missense	possibly damaging	0.85
IGL01767:Loxhd1	APN	18	77286424	missense	possibly damaging	0.71
IGL02245:Loxhd1	APN	18	77340101	missense	possibly damaging	0.71
IGL02388:Loxhd1	APN	18	77369137	missense	probably benign	0.18
IGL02410:Loxhd1	APN	18	77402952	missense	probably benign	0.02
IGL02593:Loxhd1	APN	18	77410539	missense	possibly damaging	0.91
IGL02632:Loxhd1	APN	18	77405932	missense	probably damaging	0.99
IGL02692:Loxhd1	APN	18	77356913	missense	probably damaging	0.99
IGL02796:Loxhd1	APN	18	77369115	splice site	probably benign
IGL03032:Loxhd1	APN	18	77286473	missense	possibly damaging	0.93
IGL03074:Loxhd1	APN	18	77441784	missense	possibly damaging	0.75
IGL03094:Loxhd1	APN	18	77431113	missense	possibly damaging	0.88
IGL03118:Loxhd1	APN	18	77380464	missense	probably damaging	1.00
IGL03232:Loxhd1	APN	18	77408750	missense	probably damaging	1.00
IGL03377:Loxhd1	APN	18	77441673	missense	possibly damaging	0.91
H8562:Loxhd1	UTSW	18	77341931	missense	possibly damaging	0.93
PIT4494001:Loxhd1	UTSW	18	77441768	missense	probably damaging	0.99
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0048:Loxhd1	UTSW	18	77408778	missense	probably damaging	0.99
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0208:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0323:Loxhd1	UTSW	18	77369137	missense	probably benign	0.18
R0332:Loxhd1	UTSW	18	77383830	splice site	probably null
R0367:Loxhd1	UTSW	18	77425757	splice site	probably benign
R0709:Loxhd1	UTSW	18	77404969	missense	probably benign	0.23
R0783:Loxhd1	UTSW	18	77429984	missense	possibly damaging	0.58
R1132:Loxhd1	UTSW	18	77429943	missense	possibly damaging	0.71
R1232:Loxhd1	UTSW	18	77406003	critical splice donor site	probably null
R1331:Loxhd1	UTSW	18	77402936	missense	possibly damaging	0.86
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1501:Loxhd1	UTSW	18	77356832	missense	probably damaging	1.00
R1640:Loxhd1	UTSW	18	77402563	missense	probably damaging	1.00
R1656:Loxhd1	UTSW	18	77321668	missense	possibly damaging	0.71
R1671:Loxhd1	UTSW	18	77404802	missense	probably damaging	1.00
R1725:Loxhd1	UTSW	18	77293241	missense	probably benign	0.32
R1735:Loxhd1	UTSW	18	77404889	missense	probably damaging	0.98
R1796:Loxhd1	UTSW	18	77405907	missense	probably damaging	0.96
R1796:Loxhd1	UTSW	18	77425639	missense	possibly damaging	0.88
R1800:Loxhd1	UTSW	18	77402502	missense	probably damaging	1.00
R1848:Loxhd1	UTSW	18	77281971	missense	possibly damaging	0.53
R1912:Loxhd1	UTSW	18	77340137	missense	probably benign	0.32
R1945:Loxhd1	UTSW	18	77404808	missense	probably damaging	1.00
R1978:Loxhd1	UTSW	18	77321642	missense	possibly damaging	0.86
R1997:Loxhd1	UTSW	18	77295769	missense	probably damaging	0.98
R2086:Loxhd1	UTSW	18	77384946	missense	probably damaging	1.00
R2153:Loxhd1	UTSW	18	77356166	missense	possibly damaging	0.72
R3124:Loxhd1	UTSW	18	77431078	missense	probably damaging	0.97
R3896:Loxhd1	UTSW	18	77382023	missense	possibly damaging	0.65
R3907:Loxhd1	UTSW	18	77408768	missense	possibly damaging	0.60
R3980:Loxhd1	UTSW	18	77414159	missense	probably damaging	1.00
R4165:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4166:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4176:Loxhd1	UTSW	18	77331059	missense	possibly damaging	0.53
R4345:Loxhd1	UTSW	18	77399001	missense	possibly damaging	0.89
R4354:Loxhd1	UTSW	18	77395427	missense	probably damaging	1.00
R4385:Loxhd1	UTSW	18	77372911	missense	probably damaging	0.99
R4402:Loxhd1	UTSW	18	77441760	missense	possibly damaging	0.94
R4404:Loxhd1	UTSW	18	77431132	missense	probably damaging	1.00
R4456:Loxhd1	UTSW	18	77399089	missense	probably damaging	1.00
R4525:Loxhd1	UTSW	18	77356912	missense	probably damaging	0.98
R4605:Loxhd1	UTSW	18	77405946	missense	probably benign	0.00
R4661:Loxhd1	UTSW	18	77402885	missense	possibly damaging	0.79
R4698:Loxhd1	UTSW	18	77372291	missense	possibly damaging	0.82
R4725:Loxhd1	UTSW	18	77395457	missense	probably damaging	1.00
R4820:Loxhd1	UTSW	18	77384967	missense	probably damaging	1.00
R5163:Loxhd1	UTSW	18	77361736	missense	possibly damaging	0.92
R5288:Loxhd1	UTSW	18	77363612	missense	probably damaging	1.00
R5328:Loxhd1	UTSW	18	77410572	missense	probably damaging	1.00
R5329:Loxhd1	UTSW	18	77332682	missense	probably damaging	0.98
R5347:Loxhd1	UTSW	18	77366541	missense	probably damaging	1.00
R5589:Loxhd1	UTSW	18	77342055	missense	possibly damaging	0.86
R5616:Loxhd1	UTSW	18	77404951	missense	probably damaging	1.00
R5703:Loxhd1	UTSW	18	77356877	missense	probably damaging	1.00
R5837:Loxhd1	UTSW	18	77286409	missense	possibly damaging	0.71
R5888:Loxhd1	UTSW	18	77402515	missense	probably damaging	0.99
R6021:Loxhd1	UTSW	18	77412250	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6153:Loxhd1	UTSW	18	77295758	missense	possibly damaging	0.71
R6174:Loxhd1	UTSW	18	77412178	missense	probably damaging	1.00
R6265:Loxhd1	UTSW	18	77361730	missense	probably damaging	0.99
R6377:Loxhd1	UTSW	18	77380432	missense	probably damaging	1.00
R6530:Loxhd1	UTSW	18	77412151	missense	probably benign	0.30
R6555:Loxhd1	UTSW	18	77293269	missense	possibly damaging	0.51
R6782:Loxhd1	UTSW	18	77431177	missense	probably damaging	0.99
R6834:Loxhd1	UTSW	18	77441526	missense	probably damaging	1.00
R7000:Loxhd1	UTSW	18	77372433	critical splice donor site	probably null
R7112:Loxhd1	UTSW	18	77388514	missense	probably damaging	1.00
R7203:Loxhd1	UTSW	18	77414196	missense	probably damaging	0.97
R7206:Loxhd1	UTSW	18	77441817	missense	probably damaging	0.97
R7260:Loxhd1	UTSW	18	77332642	missense	possibly damaging	0.93
R7432:Loxhd1	UTSW	18	77295851	missense	possibly damaging	0.51
R7475:Loxhd1	UTSW	18	77412305	missense	possibly damaging	0.83
R7555:Loxhd1	UTSW	18	77395365	missense	probably damaging	0.99
R7590:Loxhd1	UTSW	18	77321634	missense	possibly damaging	0.84
R7612:Loxhd1	UTSW	18	77429975	missense	possibly damaging	0.95
R7626:Loxhd1	UTSW	18	77431186	missense	possibly damaging	0.75
R7768:Loxhd1	UTSW	18	77384941	missense	probably damaging	0.99
R7791:Loxhd1	UTSW	18	77383729	missense	probably damaging	1.00
R7829:Loxhd1	UTSW	18	77408787	missense	probably damaging	0.99
R7884:Loxhd1	UTSW	18	77431213	missense	probably damaging	0.98
R7960:Loxhd1	UTSW	18	77385050	missense	probably damaging	0.99
R7986:Loxhd1	UTSW	18	77375194	missense	possibly damaging	0.88
R8042:Loxhd1	UTSW	18	77431192	missense	probably damaging	0.99
R8084:Loxhd1	UTSW	18	77340149	missense	possibly damaging	0.71
R8088:Loxhd1	UTSW	18	77342013	missense	possibly damaging	0.52
R8100:Loxhd1	UTSW	18	77404816	missense	possibly damaging	0.69
R8139:Loxhd1	UTSW	18	77380496	missense	possibly damaging	0.95
R8152:Loxhd1	UTSW	18	77388399	missense	possibly damaging	0.62
R8199:Loxhd1	UTSW	18	77381638	missense	possibly damaging	0.77
R8246:Loxhd1	UTSW	18	77363546	missense	possibly damaging	0.71
R8263:Loxhd1	UTSW	18	77375162	missense	probably damaging	1.00
R8324:Loxhd1	UTSW	18	77339579	critical splice donor site	probably null
R8342:Loxhd1	UTSW	18	77405985	missense	possibly damaging	0.88
R8401:Loxhd1	UTSW	18	77380460	missense	probably damaging	1.00
R8490:Loxhd1	UTSW	18	77441466	missense	possibly damaging	0.96
R8807:Loxhd1	UTSW	18	77356772	missense	possibly damaging	0.93
R8961:Loxhd1	UTSW	18	77385069	missense	probably damaging	1.00
R8974:Loxhd1	UTSW	18	77431203	missense	possibly damaging	0.88
R9079:Loxhd1	UTSW	18	77402897	missense	probably benign
R9284:Loxhd1	UTSW	18	77414130	missense	probably damaging	0.97
R9312:Loxhd1	UTSW	18	77410589	missense	probably benign	0.05
R9619:Loxhd1	UTSW	18	77356175	missense	probably benign	0.32
X0020:Loxhd1	UTSW	18	77339562	nonsense	probably null
X0024:Loxhd1	UTSW	18	77395403	missense	probably damaging	1.00
X0062:Loxhd1	UTSW	18	77441516	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATACCAAATCCTGCCTTCCG -3'
(R):5'- ACATGACAGCTACCTCTTCCTG -3'

Sequencing Primer
(F):5'- CGTACCACTCTGGAATACTGTAGG -3'
(R):5'- CTAGGCTTACACTCATGACTAGGG -3'

Posted On

2021-01-18