Incidental Mutation 'R8481:Sec24d'
ID 657517
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene Name Sec24 related gene family, member D (S. cerevisiae)
Synonyms 2310020L09Rik, LOC383951
MMRRC Submission
Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8481 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 123267455-123365641 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 123353424 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 677 (L677H)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
AlphaFold Q6NXL1
Predicted Effect probably damaging
Transcript: ENSMUST00000047923
AA Change: L677H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: L677H

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,556,461 Y380* probably null Het
Apob T A 12: 7,994,807 probably null Het
Aste1 G A 9: 105,396,990 R143Q possibly damaging Het
BC024139 T C 15: 76,120,682 D598G probably damaging Het
Bpifb9a T C 2: 154,269,479 V551A probably benign Het
Ccdc88b A T 19: 6,854,532 L427Q probably damaging Het
Cept1 A G 3: 106,505,253 V301A probably benign Het
Chuk G T 19: 44,096,239 H306Q probably benign Het
Cryzl1 C A 16: 91,707,273 E69* probably null Het
Cul5 A T 9: 53,646,823 D160E probably benign Het
Dlec1 G A 9: 119,143,267 probably null Het
Dnah12 A G 14: 26,853,796 M2954V probably benign Het
Dnah5 T A 15: 28,419,795 D3746E probably benign Het
Dnm1 A G 2: 32,340,478 V108A probably benign Het
Dpp9 C A 17: 56,194,467 D582Y possibly damaging Het
Evi2 T A 11: 79,515,462 probably benign Het
Got2 T A 8: 95,888,524 probably benign Het
Gria2 A T 3: 80,801,691 H61Q possibly damaging Het
Hnrnpa2b1 C T 6: 51,467,411 V8I probably benign Het
Impg2 A G 16: 56,252,266 I354V possibly damaging Het
Letm2 T C 8: 25,580,359 K421R possibly damaging Het
Lrp1 T C 10: 127,568,910 D1974G probably damaging Het
Magi2 A T 5: 20,389,154 E5D possibly damaging Het
Mprip T A 11: 59,758,156 Y895* probably null Het
Myo5c T C 9: 75,301,444 F1679S probably damaging Het
Neb T C 2: 52,224,585 K4221E probably damaging Het
Nek4 A G 14: 30,964,034 Y308C probably damaging Het
Nrsn1 T C 13: 25,253,615 N110S probably damaging Het
Olfr1286 T A 2: 111,420,649 I101F possibly damaging Het
Olfr96 T A 17: 37,225,404 I93K probably damaging Het
Padi2 A G 4: 140,933,253 Q348R probably benign Het
Pdgfrb C T 18: 61,065,742 T324I probably benign Het
Pon3 C T 6: 5,221,715 R305H probably benign Het
Prlhr A G 19: 60,467,687 V147A possibly damaging Het
Ptpn21 T C 12: 98,688,894 T605A probably benign Het
Rabep1 T C 11: 70,887,127 S162P probably damaging Het
Rgs7bp A G 13: 105,054,208 S3P probably damaging Het
Slc13a3 T C 2: 165,434,038 R263G probably damaging Het
Slu7 C A 11: 43,437,493 L45M probably damaging Het
Slu7 T A 11: 43,437,494 L45Q probably damaging Het
Sp140 A G 1: 85,641,791 D374G probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Tex36 A T 7: 133,587,460 S128T probably damaging Het
Tpbg T C 9: 85,844,085 S36P unknown Het
Tubgcp2 C A 7: 140,033,675 D30Y probably damaging Het
Vmn1r19 T C 6: 57,404,947 S162P probably damaging Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
R7481:Sec24d UTSW 3 123350763 missense probably damaging 1.00
R7554:Sec24d UTSW 3 123355774 missense probably damaging 1.00
R8270:Sec24d UTSW 3 123305886 missense possibly damaging 0.90
R8713:Sec24d UTSW 3 123343892 missense probably damaging 1.00
R8872:Sec24d UTSW 3 123354936 splice site probably benign
R8922:Sec24d UTSW 3 123350839 missense probably damaging 1.00
R8974:Sec24d UTSW 3 123305849 missense probably damaging 1.00
R9015:Sec24d UTSW 3 123327638 missense probably benign 0.43
R9050:Sec24d UTSW 3 123350725 missense probably benign 0.00
R9065:Sec24d UTSW 3 123355803 missense probably damaging 1.00
R9128:Sec24d UTSW 3 123294161 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCACACTGCCAAAGATTATGTAC -3'
(R):5'- ATGGCCGCCATTTCCACATC -3'

Sequencing Primer
(F):5'- CCCTGTAAGTATGCTAAATCA -3'
(R):5'- GGTGTTGTTCATGAATATTCCACC -3'
Posted On 2021-01-18