Incidental Mutation 'R8481:Tex36'
ID 657523
Institutional Source Beutler Lab
Gene Symbol Tex36
Ensembl Gene ENSMUSG00000030976
Gene Name testis expressed 36
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock # R8481 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 133587024-133602158 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 133587460 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 128 (S128T)
Ref Sequence ENSEMBL: ENSMUSP00000033275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033275]
AlphaFold Q9D5N9
Predicted Effect probably damaging
Transcript: ENSMUST00000033275
AA Change: S128T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033275
Gene: ENSMUSG00000030976
AA Change: S128T

DomainStartEndE-ValueType
Pfam:HDNR 1 177 1.2e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,556,461 Y380* probably null Het
Apob T A 12: 7,994,807 probably null Het
Aste1 G A 9: 105,396,990 R143Q possibly damaging Het
BC024139 T C 15: 76,120,682 D598G probably damaging Het
Bpifb9a T C 2: 154,269,479 V551A probably benign Het
Ccdc88b A T 19: 6,854,532 L427Q probably damaging Het
Cept1 A G 3: 106,505,253 V301A probably benign Het
Chuk G T 19: 44,096,239 H306Q probably benign Het
Cryzl1 C A 16: 91,707,273 E69* probably null Het
Cul5 A T 9: 53,646,823 D160E probably benign Het
Dlec1 G A 9: 119,143,267 probably null Het
Dnah12 A G 14: 26,853,796 M2954V probably benign Het
Dnah5 T A 15: 28,419,795 D3746E probably benign Het
Dnm1 A G 2: 32,340,478 V108A probably benign Het
Dpp9 C A 17: 56,194,467 D582Y possibly damaging Het
Evi2 T A 11: 79,515,462 probably benign Het
Got2 T A 8: 95,888,524 probably benign Het
Gria2 A T 3: 80,801,691 H61Q possibly damaging Het
Hnrnpa2b1 C T 6: 51,467,411 V8I probably benign Het
Impg2 A G 16: 56,252,266 I354V possibly damaging Het
Letm2 T C 8: 25,580,359 K421R possibly damaging Het
Lrp1 T C 10: 127,568,910 D1974G probably damaging Het
Magi2 A T 5: 20,389,154 E5D possibly damaging Het
Mprip T A 11: 59,758,156 Y895* probably null Het
Myo5c T C 9: 75,301,444 F1679S probably damaging Het
Neb T C 2: 52,224,585 K4221E probably damaging Het
Nek4 A G 14: 30,964,034 Y308C probably damaging Het
Nrsn1 T C 13: 25,253,615 N110S probably damaging Het
Olfr1286 T A 2: 111,420,649 I101F possibly damaging Het
Olfr96 T A 17: 37,225,404 I93K probably damaging Het
Padi2 A G 4: 140,933,253 Q348R probably benign Het
Pdgfrb C T 18: 61,065,742 T324I probably benign Het
Pon3 C T 6: 5,221,715 R305H probably benign Het
Prlhr A G 19: 60,467,687 V147A possibly damaging Het
Ptpn21 T C 12: 98,688,894 T605A probably benign Het
Rabep1 T C 11: 70,887,127 S162P probably damaging Het
Rgs7bp A G 13: 105,054,208 S3P probably damaging Het
Sec24d T A 3: 123,353,424 L677H probably damaging Het
Slc13a3 T C 2: 165,434,038 R263G probably damaging Het
Slu7 C A 11: 43,437,493 L45M probably damaging Het
Slu7 T A 11: 43,437,494 L45Q probably damaging Het
Sp140 A G 1: 85,641,791 D374G probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Tpbg T C 9: 85,844,085 S36P unknown Het
Tubgcp2 C A 7: 140,033,675 D30Y probably damaging Het
Vmn1r19 T C 6: 57,404,947 S162P probably damaging Het
Other mutations in Tex36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02412:Tex36 APN 7 133587408 missense probably benign 0.27
R1421:Tex36 UTSW 7 133595349 splice site probably null
R2061:Tex36 UTSW 7 133595223 missense probably damaging 1.00
R4580:Tex36 UTSW 7 133587382 missense possibly damaging 0.47
R4905:Tex36 UTSW 7 133587453 missense probably damaging 1.00
R5023:Tex36 UTSW 7 133595290 missense probably benign 0.00
R5532:Tex36 UTSW 7 133601983 missense probably benign 0.02
R6306:Tex36 UTSW 7 133595325 missense probably benign
R6658:Tex36 UTSW 7 133594411 missense probably damaging 1.00
R6862:Tex36 UTSW 7 133587273 missense probably benign
R7215:Tex36 UTSW 7 133587418 nonsense probably null
R7291:Tex36 UTSW 7 133587223 missense probably benign
R7428:Tex36 UTSW 7 133595137 splice site probably null
R8110:Tex36 UTSW 7 133595283 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCGCCTGATGGGATAACATC -3'
(R):5'- GAACTGTGTGACCTTGTGTATC -3'

Sequencing Primer
(F):5'- TTTAGGGATCCTGCACAAGC -3'
(R):5'- ACTGTGTGACCTTGTGTATCTCTCTC -3'
Posted On 2021-01-18