Incidental Mutation 'R8481:Sppl2b'
ID657530
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Namesignal peptide peptidase like 2B
Synonyms3110056O03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R8481 (G1)
Quality Score217.468
Status Not validated
Chromosome10
Chromosomal Location80855275-80868708 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGTCACAGGT to TGT at 80866069 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
Predicted Effect probably null
Transcript: ENSMUST00000035597
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218789
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Predicted Effect probably null
Transcript: ENSMUST00000219951
Predicted Effect probably null
Transcript: ENSMUST00000220091
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,556,461 Y380* probably null Het
Apob T A 12: 7,994,807 probably null Het
Aste1 G A 9: 105,396,990 R143Q possibly damaging Het
BC024139 T C 15: 76,120,682 D598G probably damaging Het
Bpifb9a T C 2: 154,269,479 V551A probably benign Het
Ccdc88b A T 19: 6,854,532 L427Q probably damaging Het
Cept1 A G 3: 106,505,253 V301A probably benign Het
Chuk G T 19: 44,096,239 H306Q probably benign Het
Cryzl1 C A 16: 91,707,273 E69* probably null Het
Cul5 A T 9: 53,646,823 D160E probably benign Het
Dlec1 G A 9: 119,143,267 probably null Het
Dnah12 A G 14: 26,853,796 M2954V probably benign Het
Dnah5 T A 15: 28,419,795 D3746E probably benign Het
Dnm1 A G 2: 32,340,478 V108A probably benign Het
Dpp9 C A 17: 56,194,467 D582Y possibly damaging Het
Evi2 T A 11: 79,515,462 probably benign Het
Got2 T A 8: 95,888,524 probably benign Het
Gria2 A T 3: 80,801,691 H61Q possibly damaging Het
Hnrnpa2b1 C T 6: 51,467,411 V8I probably benign Het
Impg2 A G 16: 56,252,266 I354V possibly damaging Het
Letm2 T C 8: 25,580,359 K421R possibly damaging Het
Lrp1 T C 10: 127,568,910 D1974G probably damaging Het
Magi2 A T 5: 20,389,154 E5D possibly damaging Het
Mprip T A 11: 59,758,156 Y895* probably null Het
Myo5c T C 9: 75,301,444 F1679S probably damaging Het
Neb T C 2: 52,224,585 K4221E probably damaging Het
Nek4 A G 14: 30,964,034 Y308C probably damaging Het
Nrsn1 T C 13: 25,253,615 N110S probably damaging Het
Olfr1286 T A 2: 111,420,649 I101F possibly damaging Het
Olfr96 T A 17: 37,225,404 I93K probably damaging Het
Padi2 A G 4: 140,933,253 Q348R probably benign Het
Pdgfrb C T 18: 61,065,742 T324I probably benign Het
Pon3 C T 6: 5,221,715 R305H probably benign Het
Prlhr A G 19: 60,467,687 V147A possibly damaging Het
Ptpn21 T C 12: 98,688,894 T605A probably benign Het
Rabep1 T C 11: 70,887,127 S162P probably damaging Het
Rgs7bp A G 13: 105,054,208 S3P probably damaging Het
Sec24d T A 3: 123,353,424 L677H probably damaging Het
Slc13a3 T C 2: 165,434,038 R263G probably damaging Het
Slu7 C A 11: 43,437,493 L45M probably damaging Het
Slu7 T A 11: 43,437,494 L45Q probably damaging Het
Sp140 A G 1: 85,641,791 D374G probably damaging Het
Tex36 A T 7: 133,587,460 S128T probably damaging Het
Tpbg T C 9: 85,844,085 S36P unknown Het
Tubgcp2 C A 7: 140,033,675 D30Y probably damaging Het
Vmn1r19 T C 6: 57,404,947 S162P probably damaging Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80864094 missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80865341 missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80861386 missense probably benign 0.00
IGL01964:Sppl2b APN 10 80865386 critical splice donor site probably null
IGL02376:Sppl2b APN 10 80867598 nonsense probably null
R1641:Sppl2b UTSW 10 80865131 missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80865617 missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R3106:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R4350:Sppl2b UTSW 10 80862726 missense probably benign 0.12
R5146:Sppl2b UTSW 10 80867640 makesense probably null
R5698:Sppl2b UTSW 10 80866045 splice site probably null
R6969:Sppl2b UTSW 10 80865125 missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80867419 missense probably benign 0.02
R8212:Sppl2b UTSW 10 80865359 missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80866069 frame shift probably null
R8265:Sppl2b UTSW 10 80866069 frame shift probably null
R8367:Sppl2b UTSW 10 80863191 missense probably benign 0.02
R8398:Sppl2b UTSW 10 80866068 frame shift probably null
R8398:Sppl2b UTSW 10 80866069 frame shift probably null
R8400:Sppl2b UTSW 10 80866069 frame shift probably null
R8480:Sppl2b UTSW 10 80866069 frame shift probably null
R8505:Sppl2b UTSW 10 80866069 frame shift probably null
R8817:Sppl2b UTSW 10 80866069 frame shift probably null
R8818:Sppl2b UTSW 10 80866069 frame shift probably null
R8832:Sppl2b UTSW 10 80866069 frame shift probably null
Z1176:Sppl2b UTSW 10 80867425 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TGTGCATGCCCATTGTCAC -3'
(R):5'- TGGGCCAGACACTCAACTAC -3'

Sequencing Primer
(F):5'- ATTGTCACCATCCACCTGGCAG -3'
(R):5'- GGGCCAGACACTCAACTACTCAAG -3'
Posted On2021-01-18