Incidental Mutation 'R8481:Rabep1'
ID 657535
Institutional Source Beutler Lab
Gene Symbol Rabep1
Ensembl Gene ENSMUSG00000020817
Gene Name rabaptin, RAB GTPase binding effector protein 1
Synonyms neurocrescin, RAB5 effector protein, rabaptin-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.648) question?
Stock # R8481 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 70844778-70943105 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70887127 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 162 (S162P)
Ref Sequence ENSEMBL: ENSMUSP00000098488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076270] [ENSMUST00000081362] [ENSMUST00000100928] [ENSMUST00000108533] [ENSMUST00000177731] [ENSMUST00000178245] [ENSMUST00000179114]
AlphaFold O35551
Predicted Effect probably damaging
Transcript: ENSMUST00000076270
AA Change: S162P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075619
Gene: ENSMUSG00000020817
AA Change: S162P

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.8e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 596 7.6e-39 PFAM
Pfam:Rab5-bind 612 807 5.7e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081362
AA Change: S162P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080102
Gene: ENSMUSG00000020817
AA Change: S162P

DomainStartEndE-ValueType
Pfam:Rabaptin 89 198 2.4e-45 PFAM
low complexity region 274 287 N/A INTRINSIC
Pfam:Rabaptin 421 556 7.1e-39 PFAM
Pfam:Rab5-bind 572 767 5.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100928
AA Change: S162P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098488
Gene: ENSMUSG00000020817
AA Change: S162P

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.3e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 561 2.9e-27 PFAM
Pfam:Rab5-bind 577 772 5.3e-51 PFAM
low complexity region 803 817 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108533
AA Change: S162P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104173
Gene: ENSMUSG00000020817
AA Change: S162P

DomainStartEndE-ValueType
Pfam:Rabaptin 9 495 2.8e-301 PFAM
Pfam:Rab5-bind 533 841 2e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177731
AA Change: S78P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136069
Gene: ENSMUSG00000020817
AA Change: S78P

DomainStartEndE-ValueType
Pfam:Rabaptin 5 111 6.2e-47 PFAM
low complexity region 230 243 N/A INTRINSIC
Pfam:Rabaptin 377 512 5.3e-39 PFAM
Pfam:Rab5-bind 528 723 1.4e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178245
AA Change: S119P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137267
Gene: ENSMUSG00000020817
AA Change: S119P

DomainStartEndE-ValueType
Pfam:Rabaptin 46 152 8.2e-47 PFAM
low complexity region 271 284 N/A INTRINSIC
Pfam:Rabaptin 418 553 7e-39 PFAM
Pfam:Rab5-bind 569 764 5.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179114
AA Change: S162P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136369
Gene: ENSMUSG00000020817
AA Change: S162P

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 7.1e-48 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,556,461 Y380* probably null Het
Apob T A 12: 7,994,807 probably null Het
Aste1 G A 9: 105,396,990 R143Q possibly damaging Het
BC024139 T C 15: 76,120,682 D598G probably damaging Het
Bpifb9a T C 2: 154,269,479 V551A probably benign Het
Ccdc88b A T 19: 6,854,532 L427Q probably damaging Het
Cept1 A G 3: 106,505,253 V301A probably benign Het
Chuk G T 19: 44,096,239 H306Q probably benign Het
Cryzl1 C A 16: 91,707,273 E69* probably null Het
Cul5 A T 9: 53,646,823 D160E probably benign Het
Dlec1 G A 9: 119,143,267 probably null Het
Dnah12 A G 14: 26,853,796 M2954V probably benign Het
Dnah5 T A 15: 28,419,795 D3746E probably benign Het
Dnm1 A G 2: 32,340,478 V108A probably benign Het
Dpp9 C A 17: 56,194,467 D582Y possibly damaging Het
Evi2 T A 11: 79,515,462 probably benign Het
Got2 T A 8: 95,888,524 probably benign Het
Gria2 A T 3: 80,801,691 H61Q possibly damaging Het
Hnrnpa2b1 C T 6: 51,467,411 V8I probably benign Het
Impg2 A G 16: 56,252,266 I354V possibly damaging Het
Letm2 T C 8: 25,580,359 K421R possibly damaging Het
Lrp1 T C 10: 127,568,910 D1974G probably damaging Het
Magi2 A T 5: 20,389,154 E5D possibly damaging Het
Mprip T A 11: 59,758,156 Y895* probably null Het
Myo5c T C 9: 75,301,444 F1679S probably damaging Het
Neb T C 2: 52,224,585 K4221E probably damaging Het
Nek4 A G 14: 30,964,034 Y308C probably damaging Het
Nrsn1 T C 13: 25,253,615 N110S probably damaging Het
Olfr1286 T A 2: 111,420,649 I101F possibly damaging Het
Olfr96 T A 17: 37,225,404 I93K probably damaging Het
Padi2 A G 4: 140,933,253 Q348R probably benign Het
Pdgfrb C T 18: 61,065,742 T324I probably benign Het
Pon3 C T 6: 5,221,715 R305H probably benign Het
Prlhr A G 19: 60,467,687 V147A possibly damaging Het
Ptpn21 T C 12: 98,688,894 T605A probably benign Het
Rgs7bp A G 13: 105,054,208 S3P probably damaging Het
Sec24d T A 3: 123,353,424 L677H probably damaging Het
Slc13a3 T C 2: 165,434,038 R263G probably damaging Het
Slu7 C A 11: 43,437,493 L45M probably damaging Het
Slu7 T A 11: 43,437,494 L45Q probably damaging Het
Sp140 A G 1: 85,641,791 D374G probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Tex36 A T 7: 133,587,460 S128T probably damaging Het
Tpbg T C 9: 85,844,085 S36P unknown Het
Tubgcp2 C A 7: 140,033,675 D30Y probably damaging Het
Vmn1r19 T C 6: 57,404,947 S162P probably damaging Het
Other mutations in Rabep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Rabep1 APN 11 70925781 missense probably benign 0.00
IGL02022:Rabep1 APN 11 70934559 missense probably damaging 1.00
IGL02215:Rabep1 APN 11 70923197 nonsense probably null
IGL02428:Rabep1 APN 11 70917480 missense probably benign 0.00
IGL02566:Rabep1 APN 11 70917714 missense probably damaging 1.00
IGL02868:Rabep1 APN 11 70874746 missense probably benign 0.00
F5770:Rabep1 UTSW 11 70937516 splice site probably benign
P0042:Rabep1 UTSW 11 70884975 splice site probably benign
PIT4495001:Rabep1 UTSW 11 70917579 missense probably damaging 1.00
R0328:Rabep1 UTSW 11 70919207 missense probably damaging 1.00
R0458:Rabep1 UTSW 11 70886998 splice site probably null
R0477:Rabep1 UTSW 11 70920907 missense probably damaging 1.00
R0727:Rabep1 UTSW 11 70900492 nonsense probably null
R1732:Rabep1 UTSW 11 70904641 missense probably damaging 1.00
R1837:Rabep1 UTSW 11 70904658 missense probably damaging 1.00
R2203:Rabep1 UTSW 11 70934574 missense probably damaging 1.00
R4003:Rabep1 UTSW 11 70917367 missense probably benign 0.12
R4229:Rabep1 UTSW 11 70908434 missense probably benign
R4573:Rabep1 UTSW 11 70917751 missense probably damaging 1.00
R4748:Rabep1 UTSW 11 70908468 missense probably benign 0.18
R5130:Rabep1 UTSW 11 70904731 missense probably damaging 1.00
R5182:Rabep1 UTSW 11 70904628 nonsense probably null
R5379:Rabep1 UTSW 11 70908421 missense probably damaging 1.00
R5525:Rabep1 UTSW 11 70923146 missense probably damaging 1.00
R5617:Rabep1 UTSW 11 70917529 missense probably damaging 1.00
R6283:Rabep1 UTSW 11 70917679 missense probably damaging 1.00
R6302:Rabep1 UTSW 11 70935121 missense probably damaging 1.00
R6730:Rabep1 UTSW 11 70940386 missense possibly damaging 0.88
R6988:Rabep1 UTSW 11 70934537 missense probably damaging 0.96
R7235:Rabep1 UTSW 11 70940464 missense probably benign 0.43
R7241:Rabep1 UTSW 11 70939989 missense probably damaging 1.00
R7453:Rabep1 UTSW 11 70917660 missense probably damaging 1.00
R7955:Rabep1 UTSW 11 70917441 missense probably damaging 0.96
R8175:Rabep1 UTSW 11 70884929 missense probably damaging 1.00
R8314:Rabep1 UTSW 11 70893660 missense possibly damaging 0.93
R8461:Rabep1 UTSW 11 70884855 missense possibly damaging 0.56
R8530:Rabep1 UTSW 11 70919242 missense probably damaging 1.00
R8531:Rabep1 UTSW 11 70908506 missense probably benign 0.01
R9010:Rabep1 UTSW 11 70919208 missense probably damaging 1.00
Z1186:Rabep1 UTSW 11 70940084 frame shift probably null
Z1187:Rabep1 UTSW 11 70940084 frame shift probably null
Z1188:Rabep1 UTSW 11 70940084 frame shift probably null
Z1189:Rabep1 UTSW 11 70940084 frame shift probably null
Z1190:Rabep1 UTSW 11 70940084 frame shift probably null
Z1191:Rabep1 UTSW 11 70940084 frame shift probably null
Z1192:Rabep1 UTSW 11 70940084 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACAAGGTATTTGCCCCGTAAC -3'
(R):5'- GTCATGGAAACCAAGGTATGC -3'

Sequencing Primer
(F):5'- CCCGTAACGTTAGACATGGACTATG -3'
(R):5'- TGCTGTCTAGTGCACAAGGAACTC -3'
Posted On 2021-01-18