Incidental Mutation 'R8481:Ccdc88b'
ID 657549
Institutional Source Beutler Lab
Gene Symbol Ccdc88b
Ensembl Gene ENSMUSG00000047810
Gene Name coiled-coil domain containing 88B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8481 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 6844623-6858211 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 6854532 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 427 (L427Q)
Ref Sequence ENSEMBL: ENSMUSP00000109067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113440]
AlphaFold Q4QRL3
Predicted Effect probably damaging
Transcript: ENSMUST00000113440
AA Change: L427Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109067
Gene: ENSMUSG00000047810
AA Change: L427Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 29 50 N/A INTRINSIC
Pfam:HOOK 91 503 1.2e-16 PFAM
coiled coil region 731 1308 N/A INTRINSIC
low complexity region 1420 1429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hook-related protein family. Members of this family are characterized by an N-terminal potential microtubule binding domain, a central coiled-coiled and a C-terminal Hook-related domain. The encoded protein may be involved in linking organelles to microtubules. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null ENU-induced allele exhibit decreased susceptibility to P. berghei infection with reduced T cell proliferation, decreased cytokine secretion and increased myeloid cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,556,461 Y380* probably null Het
Apob T A 12: 7,994,807 probably null Het
Aste1 G A 9: 105,396,990 R143Q possibly damaging Het
BC024139 T C 15: 76,120,682 D598G probably damaging Het
Bpifb9a T C 2: 154,269,479 V551A probably benign Het
Cept1 A G 3: 106,505,253 V301A probably benign Het
Chuk G T 19: 44,096,239 H306Q probably benign Het
Cryzl1 C A 16: 91,707,273 E69* probably null Het
Cul5 A T 9: 53,646,823 D160E probably benign Het
Dlec1 G A 9: 119,143,267 probably null Het
Dnah12 A G 14: 26,853,796 M2954V probably benign Het
Dnah5 T A 15: 28,419,795 D3746E probably benign Het
Dnm1 A G 2: 32,340,478 V108A probably benign Het
Dpp9 C A 17: 56,194,467 D582Y possibly damaging Het
Evi2 T A 11: 79,515,462 probably benign Het
Got2 T A 8: 95,888,524 probably benign Het
Gria2 A T 3: 80,801,691 H61Q possibly damaging Het
Hnrnpa2b1 C T 6: 51,467,411 V8I probably benign Het
Impg2 A G 16: 56,252,266 I354V possibly damaging Het
Letm2 T C 8: 25,580,359 K421R possibly damaging Het
Lrp1 T C 10: 127,568,910 D1974G probably damaging Het
Magi2 A T 5: 20,389,154 E5D possibly damaging Het
Mprip T A 11: 59,758,156 Y895* probably null Het
Myo5c T C 9: 75,301,444 F1679S probably damaging Het
Neb T C 2: 52,224,585 K4221E probably damaging Het
Nek4 A G 14: 30,964,034 Y308C probably damaging Het
Nrsn1 T C 13: 25,253,615 N110S probably damaging Het
Olfr1286 T A 2: 111,420,649 I101F possibly damaging Het
Olfr96 T A 17: 37,225,404 I93K probably damaging Het
Padi2 A G 4: 140,933,253 Q348R probably benign Het
Pdgfrb C T 18: 61,065,742 T324I probably benign Het
Pon3 C T 6: 5,221,715 R305H probably benign Het
Prlhr A G 19: 60,467,687 V147A possibly damaging Het
Ptpn21 T C 12: 98,688,894 T605A probably benign Het
Rabep1 T C 11: 70,887,127 S162P probably damaging Het
Rgs7bp A G 13: 105,054,208 S3P probably damaging Het
Sec24d T A 3: 123,353,424 L677H probably damaging Het
Slc13a3 T C 2: 165,434,038 R263G probably damaging Het
Slu7 C A 11: 43,437,493 L45M probably damaging Het
Slu7 T A 11: 43,437,494 L45Q probably damaging Het
Sp140 A G 1: 85,641,791 D374G probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Tex36 A T 7: 133,587,460 S128T probably damaging Het
Tpbg T C 9: 85,844,085 S36P unknown Het
Tubgcp2 C A 7: 140,033,675 D30Y probably damaging Het
Vmn1r19 T C 6: 57,404,947 S162P probably damaging Het
Other mutations in Ccdc88b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Ccdc88b APN 19 6845086 missense probably damaging 1.00
IGL01637:Ccdc88b APN 19 6846710 missense probably benign 0.13
IGL02201:Ccdc88b APN 19 6846631 missense probably damaging 1.00
IGL02260:Ccdc88b APN 19 6855349 splice site probably benign
IGL02276:Ccdc88b APN 19 6856107 critical splice donor site probably null
IGL02412:Ccdc88b APN 19 6846644 missense probably damaging 1.00
IGL02420:Ccdc88b APN 19 6856949 missense probably damaging 1.00
IGL02990:Ccdc88b APN 19 6847409 missense probably damaging 1.00
R0031:Ccdc88b UTSW 19 6853783 missense possibly damaging 0.93
R0544:Ccdc88b UTSW 19 6857266 missense probably damaging 1.00
R0727:Ccdc88b UTSW 19 6854214 missense probably benign
R0920:Ccdc88b UTSW 19 6846649 missense probably benign
R0975:Ccdc88b UTSW 19 6846625 missense probably damaging 1.00
R1170:Ccdc88b UTSW 19 6853213 missense probably damaging 1.00
R1363:Ccdc88b UTSW 19 6850371 missense possibly damaging 0.55
R1471:Ccdc88b UTSW 19 6854023 missense probably benign
R1605:Ccdc88b UTSW 19 6850469 missense probably benign 0.06
R1752:Ccdc88b UTSW 19 6853322 missense probably benign 0.02
R1832:Ccdc88b UTSW 19 6853532 nonsense probably null
R1839:Ccdc88b UTSW 19 6854109 splice site probably benign
R1917:Ccdc88b UTSW 19 6849226 missense probably damaging 1.00
R2167:Ccdc88b UTSW 19 6854084 missense possibly damaging 0.52
R4012:Ccdc88b UTSW 19 6848991 missense probably damaging 0.98
R4350:Ccdc88b UTSW 19 6850272 missense probably damaging 0.97
R4427:Ccdc88b UTSW 19 6850572 missense probably damaging 0.99
R4676:Ccdc88b UTSW 19 6853000 missense probably benign 0.00
R4677:Ccdc88b UTSW 19 6848268 missense probably damaging 0.98
R4720:Ccdc88b UTSW 19 6857715 missense probably damaging 1.00
R4725:Ccdc88b UTSW 19 6857113 missense probably damaging 1.00
R4747:Ccdc88b UTSW 19 6856141 missense probably damaging 1.00
R5092:Ccdc88b UTSW 19 6848232 missense probably damaging 0.99
R5403:Ccdc88b UTSW 19 6857740 missense unknown
R5448:Ccdc88b UTSW 19 6854580 missense probably damaging 1.00
R5771:Ccdc88b UTSW 19 6853835 missense probably benign
R5783:Ccdc88b UTSW 19 6853916 missense probably benign 0.19
R5988:Ccdc88b UTSW 19 6855980 missense probably damaging 1.00
R6328:Ccdc88b UTSW 19 6849038 missense probably damaging 1.00
R6459:Ccdc88b UTSW 19 6854878 missense possibly damaging 0.92
R6773:Ccdc88b UTSW 19 6849041 missense possibly damaging 0.71
R7073:Ccdc88b UTSW 19 6853962 missense probably benign 0.34
R7707:Ccdc88b UTSW 19 6857469 missense probably benign 0.23
R7810:Ccdc88b UTSW 19 6849086 missense probably benign
R8298:Ccdc88b UTSW 19 6850281 missense probably damaging 0.97
R8349:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8449:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8506:Ccdc88b UTSW 19 6847322 missense probably damaging 0.99
R8714:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8715:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8717:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8753:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8754:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8774:Ccdc88b UTSW 19 6847722 missense probably damaging 1.00
R8774-TAIL:Ccdc88b UTSW 19 6847722 missense probably damaging 1.00
R8787:Ccdc88b UTSW 19 6847423 missense probably damaging 1.00
R8896:Ccdc88b UTSW 19 6853835 missense probably benign
R9049:Ccdc88b UTSW 19 6849074 missense probably benign 0.37
R9100:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9113:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9197:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9198:Ccdc88b UTSW 19 6853900 missense possibly damaging 0.92
R9198:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9202:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9323:Ccdc88b UTSW 19 6849107 missense probably damaging 1.00
R9334:Ccdc88b UTSW 19 6856173 missense possibly damaging 0.50
R9385:Ccdc88b UTSW 19 6856165 missense probably benign 0.13
R9441:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9442:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
X0021:Ccdc88b UTSW 19 6853831 missense probably benign
Z1176:Ccdc88b UTSW 19 6849740 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCATCTTGCAGTGAGGGTGC -3'
(R):5'- TGACTCTAATGATGCCCAAGG -3'

Sequencing Primer
(F):5'- TGGAGACATGACCAAGTCAAACTCTG -3'
(R):5'- AATGATGCCCAAGGTTTCTCTACG -3'
Posted On 2021-01-18