Mutagenetix > Incidental Mutation

Incidental Mutation 'R8481:Ccdc88b'

657549

Institutional Source

Beutler Lab

Gene Symbol

Ccdc88b

Ensembl Gene

ENSMUSG00000047810

Gene Name

coiled-coil domain containing 88B

Synonyms

MMRRC Submission

067925-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8481 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

6844623-6858211 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 6854532 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 427 (L427Q)

Ref Sequence

ENSEMBL: ENSMUSP00000109067 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113440]

AlphaFold

Q4QRL3

Predicted Effect

probably damaging
Transcript: ENSMUST00000113440
AA Change: L427Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109067
Gene: ENSMUSG00000047810
AA Change: L427Q

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	29	50	N/A	INTRINSIC
Pfam:HOOK	91	503	1.2e-16	PFAM
coiled coil region	731	1308	N/A	INTRINSIC
low complexity region	1420	1429	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hook-related protein family. Members of this family are characterized by an N-terminal potential microtubule binding domain, a central coiled-coiled and a C-terminal Hook-related domain. The encoded protein may be involved in linking organelles to microtubules. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null ENU-induced allele exhibit decreased susceptibility to P. berghei infection with reduced T cell proliferation, decreased cytokine secretion and increased myeloid cell number. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	T	A	2: 155,556,461	Y380*	probably null	Het
Apob	T	A	12: 7,994,807		probably null	Het
Aste1	G	A	9: 105,396,990	R143Q	possibly damaging	Het
BC024139	T	C	15: 76,120,682	D598G	probably damaging	Het
Bpifb9a	T	C	2: 154,269,479	V551A	probably benign	Het
Cept1	A	G	3: 106,505,253	V301A	probably benign	Het
Chuk	G	T	19: 44,096,239	H306Q	probably benign	Het
Cryzl1	C	A	16: 91,707,273	E69*	probably null	Het
Cul5	A	T	9: 53,646,823	D160E	probably benign	Het
Dlec1	G	A	9: 119,143,267		probably null	Het
Dnah12	A	G	14: 26,853,796	M2954V	probably benign	Het
Dnah5	T	A	15: 28,419,795	D3746E	probably benign	Het
Dnm1	A	G	2: 32,340,478	V108A	probably benign	Het
Dpp9	C	A	17: 56,194,467	D582Y	possibly damaging	Het
Evi2	T	A	11: 79,515,462		probably benign	Het
Got2	T	A	8: 95,888,524		probably benign	Het
Gria2	A	T	3: 80,801,691	H61Q	possibly damaging	Het
Hnrnpa2b1	C	T	6: 51,467,411	V8I	probably benign	Het
Impg2	A	G	16: 56,252,266	I354V	possibly damaging	Het
Letm2	T	C	8: 25,580,359	K421R	possibly damaging	Het
Lrp1	T	C	10: 127,568,910	D1974G	probably damaging	Het
Magi2	A	T	5: 20,389,154	E5D	possibly damaging	Het
Mprip	T	A	11: 59,758,156	Y895*	probably null	Het
Myo5c	T	C	9: 75,301,444	F1679S	probably damaging	Het
Neb	T	C	2: 52,224,585	K4221E	probably damaging	Het
Nek4	A	G	14: 30,964,034	Y308C	probably damaging	Het
Nrsn1	T	C	13: 25,253,615	N110S	probably damaging	Het
Olfr1286	T	A	2: 111,420,649	I101F	possibly damaging	Het
Olfr96	T	A	17: 37,225,404	I93K	probably damaging	Het
Padi2	A	G	4: 140,933,253	Q348R	probably benign	Het
Pdgfrb	C	T	18: 61,065,742	T324I	probably benign	Het
Pon3	C	T	6: 5,221,715	R305H	probably benign	Het
Prlhr	A	G	19: 60,467,687	V147A	possibly damaging	Het
Ptpn21	T	C	12: 98,688,894	T605A	probably benign	Het
Rabep1	T	C	11: 70,887,127	S162P	probably damaging	Het
Rgs7bp	A	G	13: 105,054,208	S3P	probably damaging	Het
Sec24d	T	A	3: 123,353,424	L677H	probably damaging	Het
Slc13a3	T	C	2: 165,434,038	R263G	probably damaging	Het
Slu7	C	A	11: 43,437,493	L45M	probably damaging	Het
Slu7	T	A	11: 43,437,494	L45Q	probably damaging	Het
Sp140	A	G	1: 85,641,791	D374G	probably damaging	Het
Sppl2b	TGTCACAGGT	TGT	10: 80,866,069		probably null	Het
Tex36	A	T	7: 133,587,460	S128T	probably damaging	Het
Tpbg	T	C	9: 85,844,085	S36P	unknown	Het
Tubgcp2	C	A	7: 140,033,675	D30Y	probably damaging	Het
Vmn1r19	T	C	6: 57,404,947	S162P	probably damaging	Het

Other mutations in Ccdc88b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01347:Ccdc88b	APN	19	6845086	missense	probably damaging	1.00
IGL01637:Ccdc88b	APN	19	6846710	missense	probably benign	0.13
IGL02201:Ccdc88b	APN	19	6846631	missense	probably damaging	1.00
IGL02260:Ccdc88b	APN	19	6855349	splice site	probably benign
IGL02276:Ccdc88b	APN	19	6856107	critical splice donor site	probably null
IGL02412:Ccdc88b	APN	19	6846644	missense	probably damaging	1.00
IGL02420:Ccdc88b	APN	19	6856949	missense	probably damaging	1.00
IGL02990:Ccdc88b	APN	19	6847409	missense	probably damaging	1.00
R0031:Ccdc88b	UTSW	19	6853783	missense	possibly damaging	0.93
R0544:Ccdc88b	UTSW	19	6857266	missense	probably damaging	1.00
R0727:Ccdc88b	UTSW	19	6854214	missense	probably benign
R0920:Ccdc88b	UTSW	19	6846649	missense	probably benign
R0975:Ccdc88b	UTSW	19	6846625	missense	probably damaging	1.00
R1170:Ccdc88b	UTSW	19	6853213	missense	probably damaging	1.00
R1363:Ccdc88b	UTSW	19	6850371	missense	possibly damaging	0.55
R1471:Ccdc88b	UTSW	19	6854023	missense	probably benign
R1605:Ccdc88b	UTSW	19	6850469	missense	probably benign	0.06
R1752:Ccdc88b	UTSW	19	6853322	missense	probably benign	0.02
R1832:Ccdc88b	UTSW	19	6853532	nonsense	probably null
R1839:Ccdc88b	UTSW	19	6854109	splice site	probably benign
R1917:Ccdc88b	UTSW	19	6849226	missense	probably damaging	1.00
R2167:Ccdc88b	UTSW	19	6854084	missense	possibly damaging	0.52
R4012:Ccdc88b	UTSW	19	6848991	missense	probably damaging	0.98
R4350:Ccdc88b	UTSW	19	6850272	missense	probably damaging	0.97
R4427:Ccdc88b	UTSW	19	6850572	missense	probably damaging	0.99
R4676:Ccdc88b	UTSW	19	6853000	missense	probably benign	0.00
R4677:Ccdc88b	UTSW	19	6848268	missense	probably damaging	0.98
R4720:Ccdc88b	UTSW	19	6857715	missense	probably damaging	1.00
R4725:Ccdc88b	UTSW	19	6857113	missense	probably damaging	1.00
R4747:Ccdc88b	UTSW	19	6856141	missense	probably damaging	1.00
R5092:Ccdc88b	UTSW	19	6848232	missense	probably damaging	0.99
R5403:Ccdc88b	UTSW	19	6857740	missense	unknown
R5448:Ccdc88b	UTSW	19	6854580	missense	probably damaging	1.00
R5771:Ccdc88b	UTSW	19	6853835	missense	probably benign
R5783:Ccdc88b	UTSW	19	6853916	missense	probably benign	0.19
R5988:Ccdc88b	UTSW	19	6855980	missense	probably damaging	1.00
R6328:Ccdc88b	UTSW	19	6849038	missense	probably damaging	1.00
R6459:Ccdc88b	UTSW	19	6854878	missense	possibly damaging	0.92
R6773:Ccdc88b	UTSW	19	6849041	missense	possibly damaging	0.71
R7073:Ccdc88b	UTSW	19	6853962	missense	probably benign	0.34
R7707:Ccdc88b	UTSW	19	6857469	missense	probably benign	0.23
R7810:Ccdc88b	UTSW	19	6849086	missense	probably benign
R8298:Ccdc88b	UTSW	19	6850281	missense	probably damaging	0.97
R8349:Ccdc88b	UTSW	19	6855845	missense	probably damaging	1.00
R8449:Ccdc88b	UTSW	19	6855845	missense	probably damaging	1.00
R8506:Ccdc88b	UTSW	19	6847322	missense	probably damaging	0.99
R8714:Ccdc88b	UTSW	19	6855845	missense	probably damaging	1.00
R8715:Ccdc88b	UTSW	19	6855845	missense	probably damaging	1.00
R8717:Ccdc88b	UTSW	19	6855845	missense	probably damaging	1.00
R8753:Ccdc88b	UTSW	19	6855845	missense	probably damaging	1.00
R8754:Ccdc88b	UTSW	19	6855845	missense	probably damaging	1.00
R8774:Ccdc88b	UTSW	19	6847722	missense	probably damaging	1.00
R8774-TAIL:Ccdc88b	UTSW	19	6847722	missense	probably damaging	1.00
R8787:Ccdc88b	UTSW	19	6847423	missense	probably damaging	1.00
R8896:Ccdc88b	UTSW	19	6853835	missense	probably benign
R9049:Ccdc88b	UTSW	19	6849074	missense	probably benign	0.37
R9100:Ccdc88b	UTSW	19	6855845	missense	probably damaging	1.00
R9113:Ccdc88b	UTSW	19	6855845	missense	probably damaging	1.00
R9197:Ccdc88b	UTSW	19	6855845	missense	probably damaging	1.00
R9198:Ccdc88b	UTSW	19	6853900	missense	possibly damaging	0.92
R9198:Ccdc88b	UTSW	19	6855845	missense	probably damaging	1.00
R9202:Ccdc88b	UTSW	19	6855845	missense	probably damaging	1.00
R9323:Ccdc88b	UTSW	19	6849107	missense	probably damaging	1.00
R9334:Ccdc88b	UTSW	19	6856173	missense	possibly damaging	0.50
R9385:Ccdc88b	UTSW	19	6856165	missense	probably benign	0.13
R9441:Ccdc88b	UTSW	19	6855845	missense	probably damaging	1.00
R9442:Ccdc88b	UTSW	19	6855845	missense	probably damaging	1.00
R9748:Ccdc88b	UTSW	19	6854093	missense	probably damaging	1.00
R9766:Ccdc88b	UTSW	19	6855728	missense	probably damaging	1.00
X0021:Ccdc88b	UTSW	19	6853831	missense	probably benign
Z1176:Ccdc88b	UTSW	19	6849740	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TCATCTTGCAGTGAGGGTGC -3'
(R):5'- TGACTCTAATGATGCCCAAGG -3'

Sequencing Primer
(F):5'- TGGAGACATGACCAAGTCAAACTCTG -3'
(R):5'- AATGATGCCCAAGGTTTCTCTACG -3'

Posted On

2021-01-18