Incidental Mutation 'R8481:Prlhr'
ID 657551
Institutional Source Beutler Lab
Gene Symbol Prlhr
Ensembl Gene ENSMUSG00000045052
Gene Name prolactin releasing hormone receptor
Synonyms Gpr10, LOC226278, PrRPR, GR3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R8481 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 60466733-60468304 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60467687 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 147 (V147A)
Ref Sequence ENSEMBL: ENSMUSP00000063114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051277]
AlphaFold Q6VMN6
Predicted Effect possibly damaging
Transcript: ENSMUST00000051277
AA Change: V147A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063114
Gene: ENSMUSG00000045052
AA Change: V147A

DomainStartEndE-ValueType
Pfam:7tm_4 67 352 4.8e-9 PFAM
Pfam:7TM_GPCR_Srsx 71 350 7.4e-16 PFAM
Pfam:7tm_1 77 335 2.7e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PRLHR is a 7-transmembrane domain receptor for prolactin-releasing hormone (PRLH; MIM 602663) that is highly expressed in anterior pituitary (Ozawa et al., 2002 [PubMed 11923475]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene ate more than normal and became obese as they aged. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,556,461 Y380* probably null Het
Apob T A 12: 7,994,807 probably null Het
Aste1 G A 9: 105,396,990 R143Q possibly damaging Het
BC024139 T C 15: 76,120,682 D598G probably damaging Het
Bpifb9a T C 2: 154,269,479 V551A probably benign Het
Ccdc88b A T 19: 6,854,532 L427Q probably damaging Het
Cept1 A G 3: 106,505,253 V301A probably benign Het
Chuk G T 19: 44,096,239 H306Q probably benign Het
Cryzl1 C A 16: 91,707,273 E69* probably null Het
Cul5 A T 9: 53,646,823 D160E probably benign Het
Dlec1 G A 9: 119,143,267 probably null Het
Dnah12 A G 14: 26,853,796 M2954V probably benign Het
Dnah5 T A 15: 28,419,795 D3746E probably benign Het
Dnm1 A G 2: 32,340,478 V108A probably benign Het
Dpp9 C A 17: 56,194,467 D582Y possibly damaging Het
Evi2 T A 11: 79,515,462 probably benign Het
Got2 T A 8: 95,888,524 probably benign Het
Gria2 A T 3: 80,801,691 H61Q possibly damaging Het
Hnrnpa2b1 C T 6: 51,467,411 V8I probably benign Het
Impg2 A G 16: 56,252,266 I354V possibly damaging Het
Letm2 T C 8: 25,580,359 K421R possibly damaging Het
Lrp1 T C 10: 127,568,910 D1974G probably damaging Het
Magi2 A T 5: 20,389,154 E5D possibly damaging Het
Mprip T A 11: 59,758,156 Y895* probably null Het
Myo5c T C 9: 75,301,444 F1679S probably damaging Het
Neb T C 2: 52,224,585 K4221E probably damaging Het
Nek4 A G 14: 30,964,034 Y308C probably damaging Het
Nrsn1 T C 13: 25,253,615 N110S probably damaging Het
Olfr1286 T A 2: 111,420,649 I101F possibly damaging Het
Olfr96 T A 17: 37,225,404 I93K probably damaging Het
Padi2 A G 4: 140,933,253 Q348R probably benign Het
Pdgfrb C T 18: 61,065,742 T324I probably benign Het
Pon3 C T 6: 5,221,715 R305H probably benign Het
Ptpn21 T C 12: 98,688,894 T605A probably benign Het
Rabep1 T C 11: 70,887,127 S162P probably damaging Het
Rgs7bp A G 13: 105,054,208 S3P probably damaging Het
Sec24d T A 3: 123,353,424 L677H probably damaging Het
Slc13a3 T C 2: 165,434,038 R263G probably damaging Het
Slu7 C A 11: 43,437,493 L45M probably damaging Het
Slu7 T A 11: 43,437,494 L45Q probably damaging Het
Sp140 A G 1: 85,641,791 D374G probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Tex36 A T 7: 133,587,460 S128T probably damaging Het
Tpbg T C 9: 85,844,085 S36P unknown Het
Tubgcp2 C A 7: 140,033,675 D30Y probably damaging Het
Vmn1r19 T C 6: 57,404,947 S162P probably damaging Het
Other mutations in Prlhr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Prlhr APN 19 60467681 missense probably damaging 1.00
IGL02306:Prlhr APN 19 60467915 missense probably damaging 1.00
IGL02398:Prlhr APN 19 60467315 missense probably damaging 1.00
IGL02506:Prlhr APN 19 60467928 missense probably damaging 1.00
R0718:Prlhr UTSW 19 60468005 missense probably benign 0.00
R0718:Prlhr UTSW 19 60468059 nonsense probably null
R1829:Prlhr UTSW 19 60467429 missense probably damaging 1.00
R1886:Prlhr UTSW 19 60467494 nonsense probably null
R4493:Prlhr UTSW 19 60467081 missense probably benign 0.04
R4494:Prlhr UTSW 19 60467081 missense probably benign 0.04
R4495:Prlhr UTSW 19 60467081 missense probably benign 0.04
R5762:Prlhr UTSW 19 60467068 nonsense probably null
R5869:Prlhr UTSW 19 60467621 missense probably damaging 0.96
R5886:Prlhr UTSW 19 60467576 nonsense probably null
R7651:Prlhr UTSW 19 60467145 missense probably benign 0.13
R7809:Prlhr UTSW 19 60467855 missense probably damaging 1.00
R8141:Prlhr UTSW 19 60467309 missense probably damaging 1.00
R8337:Prlhr UTSW 19 60467846 missense possibly damaging 0.88
R8560:Prlhr UTSW 19 60468197 start gained probably benign
Z1177:Prlhr UTSW 19 60467315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACACCCGTACGTAAGACAG -3'
(R):5'- TGCACAACGTGACCAACTTC -3'

Sequencing Primer
(F):5'- TGCGAGCCCCAGAACTC -3'
(R):5'- AACGTGACCAACTTCCTCATTGG -3'
Posted On 2021-01-18