Incidental Mutation 'R8482:Atg9a'
ID 657552
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Name autophagy related 9A
Synonyms Apg9l1
MMRRC Submission 067926-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8482 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 75157509-75168654 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 75162870 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 410 (T410M)
Ref Sequence ENSEMBL: ENSMUSP00000139641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040689] [ENSMUST00000186744] [ENSMUST00000188347] [ENSMUST00000189665] [ENSMUST00000189702]
AlphaFold Q68FE2
Predicted Effect probably damaging
Transcript: ENSMUST00000040689
AA Change: T410M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: T410M

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186744
Predicted Effect probably benign
Transcript: ENSMUST00000187785
Predicted Effect probably damaging
Transcript: ENSMUST00000188347
AA Change: T410M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: T410M

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189702
AA Change: T410M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: T410M

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189820
AA Change: T402M

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 78,746,492 (GRCm39) V711I probably benign Het
Adprh A T 16: 38,267,871 (GRCm39) M138K probably damaging Het
Ahctf1 A G 1: 179,591,107 (GRCm39) probably benign Het
Atxn1 A T 13: 45,721,426 (GRCm39) S156R possibly damaging Het
Bptf T C 11: 106,934,524 (GRCm39) T2850A probably benign Het
Cc2d2a A T 5: 43,852,581 (GRCm39) Y386F probably damaging Het
Ccdc97 T C 7: 25,414,427 (GRCm39) D109G probably damaging Het
Chd5 C T 4: 152,441,147 (GRCm39) R196* probably null Het
Clec4a2 T C 6: 123,100,630 (GRCm39) probably null Het
Col13a1 A G 10: 61,720,477 (GRCm39) I317T probably damaging Het
D630003M21Rik G T 2: 158,058,852 (GRCm39) S349R probably benign Het
Eml5 C A 12: 98,842,560 (GRCm39) L179F probably damaging Het
Entrep1 T A 19: 23,965,866 (GRCm39) N211I probably damaging Het
Ets2 A T 16: 95,516,019 (GRCm39) M200L probably benign Het
Fat3 T C 9: 16,158,263 (GRCm39) T1116A probably benign Het
Fhit A G 14: 10,751,616 (GRCm38) V24A probably benign Het
Gm6685 T C 11: 28,289,195 (GRCm39) N207S probably benign Het
Hdc G A 2: 126,436,125 (GRCm39) T582M probably benign Het
Hmgxb4 G A 8: 75,756,222 (GRCm39) C575Y probably damaging Het
Kidins220 T A 12: 25,090,527 (GRCm39) S1164T probably benign Het
Ldb1 C A 19: 46,024,709 (GRCm39) D5Y probably null Het
Lpcat1 G A 13: 73,659,044 (GRCm39) R320H probably benign Het
Lrfn4 T C 19: 4,664,333 (GRCm39) D67G probably damaging Het
Myo15b C T 11: 115,774,083 (GRCm39) Q550* probably null Het
Myo18b C A 5: 113,019,489 (GRCm39) E43* probably null Het
Neurl1a T C 19: 47,241,719 (GRCm39) C271R probably damaging Het
Nfasc T C 1: 132,532,827 (GRCm39) S690G probably damaging Het
Ngly1 T C 14: 16,310,377 (GRCm38) S501P probably benign Het
Nlrp1a A T 11: 70,999,901 (GRCm39) probably null Het
Npw A G 17: 24,876,396 (GRCm39) W172R probably benign Het
Nudt8 T C 19: 4,050,849 (GRCm39) probably null Het
Nyap2 A T 1: 81,219,352 (GRCm39) Y458F probably damaging Het
Or10ag56 G A 2: 87,139,726 (GRCm39) V198I probably benign Het
Osbpl5 T A 7: 143,258,731 (GRCm39) T280S probably benign Het
Pex1 A T 5: 3,662,923 (GRCm39) I505F probably benign Het
Pfkm A G 15: 98,029,864 (GRCm39) E756G probably benign Het
Pkd2l2 A G 18: 34,558,166 (GRCm39) I282V possibly damaging Het
Pnpla8 T C 12: 44,330,410 (GRCm39) S321P probably benign Het
Prxl2a C T 14: 40,719,723 (GRCm39) E164K probably benign Het
Qdpr G T 5: 45,596,688 (GRCm39) Q159K probably benign Het
Rac2 T C 15: 78,450,206 (GRCm39) M45V probably benign Het
Rnaset2b G A 17: 7,263,908 (GRCm39) probably null Het
Rpl38 T A 11: 114,563,114 (GRCm39) *71R probably null Het
Sacs G T 14: 61,440,404 (GRCm39) V817L probably benign Het
Selenot T C 3: 58,495,889 (GRCm39) F133S probably damaging Het
Sgcg G A 14: 61,477,856 (GRCm39) L78F probably damaging Het
Slc19a1 A G 10: 76,885,497 (GRCm39) R466G probably benign Het
Tpr A G 1: 150,309,451 (GRCm39) T1736A probably damaging Het
Zfhx3 A G 8: 109,674,511 (GRCm39) I1854V probably benign Het
Zfp652 T C 11: 95,643,719 (GRCm39) S306P probably damaging Het
Zfp998 C T 13: 66,579,797 (GRCm39) probably benign Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75,167,010 (GRCm39) missense probably damaging 1.00
IGL02041:Atg9a APN 1 75,159,748 (GRCm39) missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75,164,601 (GRCm39) missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75,164,597 (GRCm39) nonsense probably null
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0408:Atg9a UTSW 1 75,161,939 (GRCm39) missense probably damaging 1.00
R0520:Atg9a UTSW 1 75,163,178 (GRCm39) nonsense probably null
R0653:Atg9a UTSW 1 75,166,972 (GRCm39) missense probably damaging 0.96
R0666:Atg9a UTSW 1 75,161,734 (GRCm39) missense probably damaging 0.99
R0961:Atg9a UTSW 1 75,163,390 (GRCm39) missense probably damaging 0.99
R1489:Atg9a UTSW 1 75,162,734 (GRCm39) missense probably damaging 1.00
R1490:Atg9a UTSW 1 75,162,389 (GRCm39) missense possibly damaging 0.70
R1692:Atg9a UTSW 1 75,166,999 (GRCm39) missense probably benign 0.04
R1997:Atg9a UTSW 1 75,166,270 (GRCm39) missense probably benign 0.33
R2005:Atg9a UTSW 1 75,162,635 (GRCm39) missense probably benign 0.18
R2172:Atg9a UTSW 1 75,162,329 (GRCm39) missense probably damaging 0.99
R4004:Atg9a UTSW 1 75,163,095 (GRCm39) missense probably damaging 1.00
R4105:Atg9a UTSW 1 75,162,603 (GRCm39) missense probably damaging 1.00
R5010:Atg9a UTSW 1 75,162,704 (GRCm39) splice site probably null
R5220:Atg9a UTSW 1 75,162,372 (GRCm39) missense probably damaging 1.00
R5898:Atg9a UTSW 1 75,162,916 (GRCm39) missense probably damaging 1.00
R6295:Atg9a UTSW 1 75,161,702 (GRCm39) missense probably benign 0.01
R6390:Atg9a UTSW 1 75,164,625 (GRCm39) missense probably damaging 1.00
R7312:Atg9a UTSW 1 75,164,736 (GRCm39) missense probably damaging 1.00
R7729:Atg9a UTSW 1 75,161,204 (GRCm39) missense probably benign 0.34
R8111:Atg9a UTSW 1 75,164,366 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,163,009 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,161,927 (GRCm39) missense probably damaging 1.00
R8256:Atg9a UTSW 1 75,163,563 (GRCm39) missense possibly damaging 0.88
R8319:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8321:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8382:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8406:Atg9a UTSW 1 75,167,028 (GRCm39) missense probably damaging 1.00
R8855:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R8866:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R9381:Atg9a UTSW 1 75,162,726 (GRCm39) missense probably benign
R9441:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9442:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9448:Atg9a UTSW 1 75,162,849 (GRCm39) missense probably benign 0.35
R9608:Atg9a UTSW 1 75,161,739 (GRCm39) missense possibly damaging 0.52
R9703:Atg9a UTSW 1 75,162,431 (GRCm39) missense probably damaging 0.98
RF021:Atg9a UTSW 1 75,159,273 (GRCm39) missense probably damaging 0.96
Z1176:Atg9a UTSW 1 75,163,203 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGCAAGAATCACTCGGAG -3'
(R):5'- ACCTCCGCCACTTCAATGAG -3'

Sequencing Primer
(F):5'- AATCACTCGGAGCAGCTG -3'
(R):5'- CCACTTCAATGAGCTGGAGCATG -3'
Posted On 2021-01-18