Incidental Mutation 'R8482:Acan'
ID 657566
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Name aggrecan
Synonyms Agc1, b2b183Clo, Cspg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8482 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 79053483-79115099 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 79096744 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 711 (V711I)
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
AlphaFold Q61282
Predicted Effect probably benign
Transcript: ENSMUST00000032835
AA Change: V711I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607
AA Change: V711I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206779
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik C T 13: 66,431,738 probably benign Het
Adprh A T 16: 38,447,509 M138K probably damaging Het
Ahctf1 A G 1: 179,763,542 probably benign Het
Atg9a G A 1: 75,186,226 T410M probably damaging Het
Atxn1 A T 13: 45,567,950 S156R possibly damaging Het
Bptf T C 11: 107,043,698 T2850A probably benign Het
Cc2d2a A T 5: 43,695,239 Y386F probably damaging Het
Ccdc97 T C 7: 25,715,002 D109G probably damaging Het
Chd5 C T 4: 152,356,690 R196* probably null Het
Clec4a2 T C 6: 123,123,671 probably null Het
Col13a1 A G 10: 61,884,698 I317T probably damaging Het
D630003M21Rik G T 2: 158,216,932 S349R probably benign Het
Eml5 C A 12: 98,876,301 L179F probably damaging Het
Ets2 A T 16: 95,714,975 M200L probably benign Het
Fam189a2 T A 19: 23,988,502 N211I probably damaging Het
Fam213a C T 14: 40,997,766 E164K probably benign Het
Fat3 T C 9: 16,246,967 T1116A probably benign Het
Fhit A G 14: 10,751,616 V24A probably benign Het
Gm6685 T C 11: 28,339,195 N207S probably benign Het
Hdc G A 2: 126,594,205 T582M probably benign Het
Hmgxb4 G A 8: 75,029,594 C575Y probably damaging Het
Kidins220 T A 12: 25,040,528 S1164T probably benign Het
Ldb1 C A 19: 46,036,270 D5Y probably null Het
Lpcat1 G A 13: 73,510,925 R320H probably benign Het
Lrfn4 T C 19: 4,614,305 D67G probably damaging Het
Myo15b C T 11: 115,883,257 Q550* probably null Het
Myo18b C A 5: 112,871,623 E43* probably null Het
Neurl1a T C 19: 47,253,280 C271R probably damaging Het
Nfasc T C 1: 132,605,089 S690G probably damaging Het
Ngly1 T C 14: 16,310,377 S501P probably benign Het
Nlrp1a A T 11: 71,109,075 probably null Het
Npw A G 17: 24,657,422 W172R probably benign Het
Nudt8 T C 19: 4,000,849 probably null Het
Nyap2 A T 1: 81,241,637 Y458F probably damaging Het
Olfr1118 G A 2: 87,309,382 V198I probably benign Het
Osbpl5 T A 7: 143,704,994 T280S probably benign Het
Pex1 A T 5: 3,612,923 I505F probably benign Het
Pfkm A G 15: 98,131,983 E756G probably benign Het
Pkd2l2 A G 18: 34,425,113 I282V possibly damaging Het
Pnpla8 T C 12: 44,283,627 S321P probably benign Het
Qdpr G T 5: 45,439,346 Q159K probably benign Het
Rac2 T C 15: 78,566,006 M45V probably benign Het
Rnaset2b G A 17: 6,996,509 probably null Het
Rpl38 T A 11: 114,672,288 *71R probably null Het
Sacs G T 14: 61,202,955 V817L probably benign Het
Selenot T C 3: 58,588,468 F133S probably damaging Het
Sgcg G A 14: 61,240,407 L78F probably damaging Het
Slc19a1 A G 10: 77,049,663 R466G probably benign Het
Tpr A G 1: 150,433,700 T1736A probably damaging Het
Zfhx3 A G 8: 108,947,879 I1854V probably benign Het
Zfp652 T C 11: 95,752,893 S306P probably damaging Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 79097824 missense probably benign 0.00
IGL01118:Acan APN 7 79098653 missense possibly damaging 0.78
IGL01145:Acan APN 7 79099282 missense probably damaging 1.00
IGL01308:Acan APN 7 79099249 missense probably damaging 0.98
IGL01520:Acan APN 7 79084570 missense probably damaging 0.96
IGL02069:Acan APN 7 79092752 missense possibly damaging 0.83
IGL02629:Acan APN 7 79111979 missense possibly damaging 0.90
IGL02713:Acan APN 7 79100244 missense possibly damaging 0.90
IGL03001:Acan APN 7 79111294 missense probably damaging 0.99
IGL03081:Acan APN 7 79098543 missense probably benign 0.01
Disproportion UTSW 7 79092318 missense probably damaging 0.98
Hollowleg UTSW 7 79098348 nonsense probably null
Sublimate UTSW 7 79111320 missense probably damaging 0.97
Vacuo UTSW 7 79088307 critical splice donor site probably null
IGL03147:Acan UTSW 7 79091056 missense probably damaging 1.00
R0281:Acan UTSW 7 79100285 missense probably damaging 1.00
R0372:Acan UTSW 7 79100601 missense probably benign 0.00
R0599:Acan UTSW 7 79111290 splice site probably benign
R0827:Acan UTSW 7 79099671 missense probably benign 0.00
R0835:Acan UTSW 7 79114232 missense probably damaging 0.96
R1496:Acan UTSW 7 79100804 missense probably benign 0.06
R1716:Acan UTSW 7 79082198 missense unknown
R1761:Acan UTSW 7 79094085 nonsense probably null
R1848:Acan UTSW 7 79099035 missense probably benign
R2002:Acan UTSW 7 79100793 missense probably damaging 1.00
R2025:Acan UTSW 7 79101222 missense probably benign
R2167:Acan UTSW 7 79099957 missense probably benign 0.41
R2189:Acan UTSW 7 79098091 missense probably damaging 1.00
R2303:Acan UTSW 7 79099957 missense probably benign 0.41
R2496:Acan UTSW 7 79111317 missense probably damaging 1.00
R2971:Acan UTSW 7 79099699 missense possibly damaging 0.46
R4004:Acan UTSW 7 79100687 missense probably damaging 1.00
R4669:Acan UTSW 7 79101142 missense probably benign 0.01
R4732:Acan UTSW 7 79098609 missense probably damaging 0.99
R4733:Acan UTSW 7 79098609 missense probably damaging 0.99
R4742:Acan UTSW 7 79100769 missense probably benign 0.41
R4750:Acan UTSW 7 79092718 missense probably damaging 1.00
R5022:Acan UTSW 7 79092808 critical splice donor site probably null
R5122:Acan UTSW 7 79100661 missense probably damaging 0.99
R5190:Acan UTSW 7 79098541 missense probably benign 0.03
R5220:Acan UTSW 7 79088297 missense probably damaging 0.96
R5414:Acan UTSW 7 79100988 missense probably benign 0.00
R5525:Acan UTSW 7 79099983 missense probably benign
R5655:Acan UTSW 7 79100043 missense possibly damaging 0.89
R5662:Acan UTSW 7 79100107 missense possibly damaging 0.78
R5748:Acan UTSW 7 79089699 missense probably damaging 0.98
R5758:Acan UTSW 7 79101214 missense possibly damaging 0.67
R5996:Acan UTSW 7 79111320 missense probably damaging 0.97
R6057:Acan UTSW 7 79099782 missense probably null
R6503:Acan UTSW 7 79097832 missense probably benign 0.04
R6529:Acan UTSW 7 79089731 missense probably benign 0.16
R6887:Acan UTSW 7 79092483 missense probably damaging 1.00
R7041:Acan UTSW 7 79098348 nonsense probably null
R7193:Acan UTSW 7 79086342 missense probably damaging 1.00
R7220:Acan UTSW 7 79108148 missense
R7263:Acan UTSW 7 79092318 missense probably damaging 0.98
R7376:Acan UTSW 7 79088307 critical splice donor site probably null
R7502:Acan UTSW 7 79094203 missense probably damaging 1.00
R7571:Acan UTSW 7 79086267 missense probably damaging 1.00
R7709:Acan UTSW 7 79089608 missense probably damaging 1.00
R7835:Acan UTSW 7 79099875 missense probably benign 0.08
R8051:Acan UTSW 7 79100779 missense probably damaging 0.96
R8131:Acan UTSW 7 79091338 missense possibly damaging 0.92
R8138:Acan UTSW 7 79098427 missense probably benign 0.12
R8324:Acan UTSW 7 79091056 missense probably damaging 1.00
R8511:Acan UTSW 7 79097935 missense possibly damaging 0.94
R8716:Acan UTSW 7 79112690 missense probably damaging 1.00
R8753:Acan UTSW 7 79098768 missense possibly damaging 0.83
R8810:Acan UTSW 7 79099704 missense probably damaging 1.00
R8898:Acan UTSW 7 79100353 missense possibly damaging 0.59
R8956:Acan UTSW 7 79100965 missense probably benign 0.00
R9199:Acan UTSW 7 79086309 missense probably damaging 1.00
RF008:Acan UTSW 7 79092400 missense possibly damaging 0.83
Z1088:Acan UTSW 7 79088200 nonsense probably null
Z1088:Acan UTSW 7 79100110 missense probably benign 0.41
Z1088:Acan UTSW 7 79111354 missense probably benign
Z1176:Acan UTSW 7 79111354 missense probably benign
Z1177:Acan UTSW 7 79094170 missense probably damaging 0.96
Z1177:Acan UTSW 7 79100137 missense probably damaging 0.99
Z1177:Acan UTSW 7 79111354 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTGTACAGGACAGGTGTACCTC -3'
(R):5'- ATTCCATAGCAGGCAGGAGTG -3'

Sequencing Primer
(F):5'- ACAGGTGTACCTCAGGGTC -3'
(R):5'- AGTGCACGTGGCTTCAG -3'
Posted On 2021-01-18