Incidental Mutation 'R8482:Rac2'
ID657589
Institutional Source Beutler Lab
Gene Symbol Rac2
Ensembl Gene ENSMUSG00000033220
Gene NameRac family small GTPase 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8482 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location78559167-78572783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78566006 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 45 (M45V)
Ref Sequence ENSEMBL: ENSMUSP00000036384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043214] [ENSMUST00000229394]
Predicted Effect probably benign
Transcript: ENSMUST00000043214
AA Change: M45V

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000036384
Gene: ENSMUSG00000033220
AA Change: M45V

DomainStartEndE-ValueType
RHO 6 179 3.36e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229394
Predicted Effect probably benign
Transcript: ENSMUST00000230952
Meta Mutation Damage Score 0.1733 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit peripheral blood lymphocytosis, reductions in peritoneal B-1a lymphocytes, marginal zone lymphocytes, and IgM-secreting plasma cells, decreased levels of serum IgM and IgA, and abnormal T cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik C T 13: 66,431,738 probably benign Het
Acan G A 7: 79,096,744 V711I probably benign Het
Adprh A T 16: 38,447,509 M138K probably damaging Het
Ahctf1 A G 1: 179,763,542 probably benign Het
Atg9a G A 1: 75,186,226 T410M probably damaging Het
Atxn1 A T 13: 45,567,950 S156R possibly damaging Het
Bptf T C 11: 107,043,698 T2850A probably benign Het
Cc2d2a A T 5: 43,695,239 Y386F probably damaging Het
Ccdc97 T C 7: 25,715,002 D109G probably damaging Het
Chd5 C T 4: 152,356,690 R196* probably null Het
Clec4a2 T C 6: 123,123,671 probably null Het
Col13a1 A G 10: 61,884,698 I317T probably damaging Het
D630003M21Rik G T 2: 158,216,932 S349R probably benign Het
Eml5 C A 12: 98,876,301 L179F probably damaging Het
Ets2 A T 16: 95,714,975 M200L probably benign Het
Fam189a2 T A 19: 23,988,502 N211I probably damaging Het
Fam213a C T 14: 40,997,766 E164K probably benign Het
Fat3 T C 9: 16,246,967 T1116A probably benign Het
Fhit A G 14: 10,751,616 V24A probably benign Het
Gm6685 T C 11: 28,339,195 N207S probably benign Het
Hdc G A 2: 126,594,205 T582M probably benign Het
Hmgxb4 G A 8: 75,029,594 C575Y probably damaging Het
Kidins220 T A 12: 25,040,528 S1164T probably benign Het
Ldb1 C A 19: 46,036,270 D5Y probably null Het
Lpcat1 G A 13: 73,510,925 R320H probably benign Het
Lrfn4 T C 19: 4,614,305 D67G probably damaging Het
Myo15b C T 11: 115,883,257 Q550* probably null Het
Myo18b C A 5: 112,871,623 E43* probably null Het
Neurl1a T C 19: 47,253,280 C271R probably damaging Het
Nfasc T C 1: 132,605,089 S690G probably damaging Het
Ngly1 T C 14: 16,310,377 S501P probably benign Het
Nlrp1a A T 11: 71,109,075 probably null Het
Npw A G 17: 24,657,422 W172R probably benign Het
Nudt8 T C 19: 4,000,849 probably null Het
Nyap2 A T 1: 81,241,637 Y458F probably damaging Het
Olfr1118 G A 2: 87,309,382 V198I probably benign Het
Osbpl5 T A 7: 143,704,994 T280S probably benign Het
Pex1 A T 5: 3,612,923 I505F probably benign Het
Pfkm A G 15: 98,131,983 E756G probably benign Het
Pkd2l2 A G 18: 34,425,113 I282V possibly damaging Het
Pnpla8 T C 12: 44,283,627 S321P probably benign Het
Qdpr G T 5: 45,439,346 Q159K probably benign Het
Rnaset2b G A 17: 6,996,509 probably null Het
Rpl38 T A 11: 114,672,288 *71R probably null Het
Sacs G T 14: 61,202,955 V817L probably benign Het
Selenot T C 3: 58,588,468 F133S probably damaging Het
Sgcg G A 14: 61,240,407 L78F probably damaging Het
Slc19a1 A G 10: 77,049,663 R466G probably benign Het
Tpr A G 1: 150,433,700 T1736A probably damaging Het
Zfhx3 A G 8: 108,947,879 I1854V probably benign Het
Zfp652 T C 11: 95,752,893 S306P probably damaging Het
Other mutations in Rac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Rac2 APN 15 78570747 missense possibly damaging 0.79
Big_bend UTSW 15 78565945 missense possibly damaging 0.95
bingo UTSW 15 78564968 missense probably damaging 1.00
Lamb UTSW 15 78564934 missense possibly damaging 0.68
Potter UTSW 15 78570743 nonsense probably null
Potter2 UTSW 15 78565454 missense probably damaging 0.97
wheel UTSW 15 78566006 missense probably benign 0.29
R0557:Rac2 UTSW 15 78564974 missense probably damaging 1.00
R0627:Rac2 UTSW 15 78564968 missense probably damaging 1.00
R0751:Rac2 UTSW 15 78565945 missense possibly damaging 0.95
R1184:Rac2 UTSW 15 78565945 missense possibly damaging 0.95
R2349:Rac2 UTSW 15 78565475 missense possibly damaging 0.51
R3816:Rac2 UTSW 15 78565999 missense possibly damaging 0.75
R4436:Rac2 UTSW 15 78570743 nonsense probably null
R5051:Rac2 UTSW 15 78564934 missense possibly damaging 0.68
R5207:Rac2 UTSW 15 78565454 missense probably damaging 0.97
R7384:Rac2 UTSW 15 78561931 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTCGGGGCATGGTGATACTC -3'
(R):5'- TTGTGGAAACAGCCAGTTGC -3'

Sequencing Primer
(F):5'- TGATACTCGGGGCAGCATG -3'
(R):5'- AACAGCCAGTTGCACGGTG -3'
Posted On2021-01-18