Incidental Mutation 'R8483:Kank4'
ID657612
Institutional Source Beutler Lab
Gene Symbol Kank4
Ensembl Gene ENSMUSG00000035407
Gene NameKN motif and ankyrin repeat domains 4
SynonymsAnkrd38
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8483 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location98754898-98817537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98771378 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 821 (Q821L)
Ref Sequence ENSEMBL: ENSMUSP00000099851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102790]
Predicted Effect probably damaging
Transcript: ENSMUST00000102790
AA Change: Q821L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099851
Gene: ENSMUSG00000035407
AA Change: Q821L

DomainStartEndE-ValueType
Pfam:KN_motif 24 62 5.6e-26 PFAM
low complexity region 280 295 N/A INTRINSIC
low complexity region 300 320 N/A INTRINSIC
coiled coil region 345 409 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 600 624 N/A INTRINSIC
low complexity region 625 655 N/A INTRINSIC
low complexity region 685 709 N/A INTRINSIC
ANK 838 868 7.42e-4 SMART
ANK 877 905 2.08e3 SMART
ANK 910 939 1.11e-2 SMART
ANK 943 973 8.99e-3 SMART
ANK 977 1006 2.43e3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,919 Y76C probably benign Het
AF366264 T A 8: 13,838,229 probably benign Het
Ang6 A G 14: 44,001,828 *148Q probably null Het
Aurkc T A 7: 6,996,665 L57* probably null Het
Brca1 T C 11: 101,525,976 D444G probably damaging Het
Cdhr4 T C 9: 107,994,999 V204A probably damaging Het
Chd7 A G 4: 8,822,412 D835G possibly damaging Het
Cux1 C A 5: 136,275,090 A1328S possibly damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Cyp39a1 A G 17: 43,683,007 D186G probably benign Het
Dnah3 T C 7: 119,937,030 I3677V probably benign Het
Dnmt3b A G 2: 153,674,386 D477G probably damaging Het
Drc1 A T 5: 30,350,441 Y269F probably benign Het
Esco2 T C 14: 65,831,669 H64R probably benign Het
Fam46c T A 3: 100,472,468 H324L probably damaging Het
Gcnt3 A T 9: 70,034,677 V203E probably damaging Het
Gm609 T A 16: 45,419,872 I134F possibly damaging Het
Gpam A C 19: 55,088,942 V139G probably damaging Het
Gsta3 G A 1: 21,262,839 S104N probably damaging Het
Hsd17b13 C T 5: 103,977,183 G45R probably damaging Het
Ighe T C 12: 113,272,188 M173V Het
Ipo5 A G 14: 120,946,148 E1046G probably benign Het
Kat6b G T 14: 21,669,393 S1271I probably damaging Het
Klhl1 A G 14: 96,381,934 S176P probably benign Het
Lbhd2 G A 12: 111,411,756 D86N probably damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Lrrc55 A T 2: 85,191,951 C299S probably benign Het
Nprl3 T A 11: 32,263,083 S44C probably damaging Het
Nucks1 A G 1: 131,928,091 H86R possibly damaging Het
Olfr114 A G 17: 37,589,975 V126A possibly damaging Het
Olfr1191-ps1 A G 2: 88,643,334 D189G probably benign Het
Olfr818 T A 10: 129,945,129 H311L probably benign Het
Ovgp1 T A 3: 105,986,995 probably benign Het
Patj C A 4: 98,424,302 H292Q probably damaging Het
Pcdha9 A G 18: 36,998,583 N235S probably benign Het
Pcdhb12 A T 18: 37,437,537 T579S possibly damaging Het
Pde3b A G 7: 114,519,568 I647M probably benign Het
Pdp1 T C 4: 11,961,982 R110G probably benign Het
Prb1 T G 6: 132,208,435 R78S unknown Het
Rnf165 G A 18: 77,468,338 A174V probably benign Het
Slc35f2 T A 9: 53,809,701 Y249* probably null Het
Sra1 A G 18: 36,667,826 I153T probably benign Het
Stk38l T A 6: 146,758,519 H16Q possibly damaging Het
Unc80 T C 1: 66,693,710 S3073P possibly damaging Het
Usp24 T C 4: 106,373,756 I844T probably damaging Het
V1ra8 A T 6: 90,202,934 I40F probably benign Het
Vmn2r88 T A 14: 51,413,073 M81K possibly damaging Het
Vps8 T C 16: 21,575,013 I1182T probably damaging Het
Wdr54 A G 6: 83,153,610 V181A probably benign Het
Zbed4 A G 15: 88,781,787 Y686C probably damaging Het
Zfyve28 T C 5: 34,236,136 N62S possibly damaging Het
Zic1 T C 9: 91,364,371 Y216C probably damaging Het
Other mutations in Kank4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Kank4 APN 4 98778395 missense probably damaging 0.99
IGL02634:Kank4 APN 4 98778827 missense probably benign 0.06
IGL02883:Kank4 APN 4 98773453 missense possibly damaging 0.87
R0040:Kank4 UTSW 4 98779220 missense probably benign 0.03
R0040:Kank4 UTSW 4 98779220 missense probably benign 0.03
R0081:Kank4 UTSW 4 98778330 missense probably benign 0.02
R0219:Kank4 UTSW 4 98778465 missense probably benign 0.06
R0498:Kank4 UTSW 4 98779636 missense probably benign
R0609:Kank4 UTSW 4 98777105 missense probably damaging 0.99
R0855:Kank4 UTSW 4 98771444 missense probably damaging 1.00
R0865:Kank4 UTSW 4 98774663 splice site probably benign
R0961:Kank4 UTSW 4 98756519 missense probably benign 0.02
R1172:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1173:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1175:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1381:Kank4 UTSW 4 98779938 missense probably damaging 0.98
R1517:Kank4 UTSW 4 98779029 missense possibly damaging 0.83
R1573:Kank4 UTSW 4 98774836 nonsense probably null
R1668:Kank4 UTSW 4 98778896 missense probably damaging 0.98
R2051:Kank4 UTSW 4 98780102 missense probably damaging 0.99
R2253:Kank4 UTSW 4 98779226 missense probably damaging 0.99
R2656:Kank4 UTSW 4 98778957 missense probably damaging 0.99
R3801:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3802:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3804:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3945:Kank4 UTSW 4 98771280 missense probably damaging 1.00
R4172:Kank4 UTSW 4 98779121 missense probably damaging 1.00
R4502:Kank4 UTSW 4 98777098 missense possibly damaging 0.89
R4503:Kank4 UTSW 4 98777098 missense possibly damaging 0.89
R5024:Kank4 UTSW 4 98785661 missense probably damaging 0.99
R5105:Kank4 UTSW 4 98779159 missense probably benign 0.01
R5122:Kank4 UTSW 4 98756567 missense probably damaging 1.00
R5255:Kank4 UTSW 4 98778972 missense probably benign
R5484:Kank4 UTSW 4 98774785 missense probably benign
R5517:Kank4 UTSW 4 98774881 missense probably damaging 1.00
R5550:Kank4 UTSW 4 98771441 missense probably benign 0.27
R5667:Kank4 UTSW 4 98765461 critical splice donor site probably null
R5671:Kank4 UTSW 4 98765461 critical splice donor site probably null
R5865:Kank4 UTSW 4 98771393 missense possibly damaging 0.50
R6176:Kank4 UTSW 4 98765554 missense probably damaging 1.00
R6778:Kank4 UTSW 4 98761505 missense probably benign 0.01
R7084:Kank4 UTSW 4 98771345 missense probably damaging 1.00
R7085:Kank4 UTSW 4 98779946 missense probably benign
R7112:Kank4 UTSW 4 98761521 missense probably damaging 0.99
R8307:Kank4 UTSW 4 98778678 nonsense probably null
R8431:Kank4 UTSW 4 98779272 missense probably benign 0.33
R8447:Kank4 UTSW 4 98778492 missense probably damaging 0.99
R8505:Kank4 UTSW 4 98785676 start gained probably benign
X0027:Kank4 UTSW 4 98779923 missense probably benign 0.00
Z1176:Kank4 UTSW 4 98778294 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTGGACTACAAGAGGAATTCAG -3'
(R):5'- CAAGGTCACTGGGAGATCCAAC -3'

Sequencing Primer
(F):5'- ACTGTAGTGCCAGCTACTCATGAG -3'
(R):5'- TCACTGGGAGATCCAACTAGGGTAC -3'
Posted On2021-01-18