Incidental Mutation 'R8483:AF366264'
ID 657625
Institutional Source Beutler Lab
Gene Symbol AF366264
Ensembl Gene ENSMUSG00000057116
Gene Name cDNA sequence AF366264
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock # R8483 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 13835233-13838389 bp(-) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) T to A at 13838229 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071308]
AlphaFold G3X9P9
Predicted Effect probably benign
Transcript: ENSMUST00000071308
SMART Domains Protein: ENSMUSP00000096518
Gene: ENSMUSG00000057116

DomainStartEndE-ValueType
Pfam:Peptidase_C48 322 501 1.9e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,919 Y76C probably benign Het
Ang6 A G 14: 44,001,828 *148Q probably null Het
Ankrd28 A T 14: 31,735,091 probably null Het
Aurkc T A 7: 6,996,665 L57* probably null Het
Brca1 T C 11: 101,525,976 D444G probably damaging Het
Cdhr4 T C 9: 107,994,999 V204A probably damaging Het
Chd7 A G 4: 8,822,412 D835G possibly damaging Het
Cux1 C A 5: 136,275,090 A1328S possibly damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Cyp39a1 A G 17: 43,683,007 D186G probably benign Het
Dnah3 T C 7: 119,937,030 I3677V probably benign Het
Dnmt3b A G 2: 153,674,386 D477G probably damaging Het
Drc1 A T 5: 30,350,441 Y269F probably benign Het
Esco2 T C 14: 65,831,669 H64R probably benign Het
Fam46c T A 3: 100,472,468 H324L probably damaging Het
Gcnt3 A T 9: 70,034,677 V203E probably damaging Het
Gm609 T A 16: 45,419,872 I134F possibly damaging Het
Gpam A C 19: 55,088,942 V139G probably damaging Het
Gsta3 G A 1: 21,262,839 S104N probably damaging Het
Hsd17b13 C T 5: 103,977,183 G45R probably damaging Het
Ighe T C 12: 113,272,188 M173V Het
Ipo5 A G 14: 120,946,148 E1046G probably benign Het
Kank4 T A 4: 98,771,378 Q821L probably damaging Het
Kat6b G T 14: 21,669,393 S1271I probably damaging Het
Klhl1 A G 14: 96,381,934 S176P probably benign Het
Lbhd2 G A 12: 111,411,756 D86N probably damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Lrrc55 A T 2: 85,191,951 C299S probably benign Het
Nprl3 T A 11: 32,263,083 S44C probably damaging Het
Nucks1 A G 1: 131,928,091 H86R possibly damaging Het
Olfr114 A G 17: 37,589,975 V126A possibly damaging Het
Olfr1191-ps1 A G 2: 88,643,334 D189G probably benign Het
Olfr818 T A 10: 129,945,129 H311L probably benign Het
Ovgp1 T A 3: 105,986,995 probably benign Het
Oxa1l G A 14: 54,368,544 probably null Het
Patj C A 4: 98,424,302 H292Q probably damaging Het
Pcdha9 A G 18: 36,998,583 N235S probably benign Het
Pcdhb12 A T 18: 37,437,537 T579S possibly damaging Het
Pde3b A G 7: 114,519,568 I647M probably benign Het
Pdp1 T C 4: 11,961,982 R110G probably benign Het
Prb1 T G 6: 132,208,435 R78S unknown Het
Prmt8 A C 6: 127,704,013 probably null Het
Rnf165 G A 18: 77,468,338 A174V probably benign Het
Slc35f2 T A 9: 53,809,701 Y249* probably null Het
Smok2b A C 17: 13,235,021 M23L probably benign Het
Sra1 A G 18: 36,667,826 I153T probably benign Het
Stk38l T A 6: 146,758,519 H16Q possibly damaging Het
Unc80 T C 1: 66,693,710 S3073P possibly damaging Het
Usp24 T C 4: 106,373,756 I844T probably damaging Het
V1ra8 A T 6: 90,202,934 I40F probably benign Het
Vmn2r88 T A 14: 51,413,073 M81K possibly damaging Het
Vps8 T C 16: 21,575,013 I1182T probably damaging Het
Wdr54 A G 6: 83,153,610 V181A probably benign Het
Zbed4 A G 15: 88,781,787 Y686C probably damaging Het
Zfyve28 T C 5: 34,236,136 N62S possibly damaging Het
Zic1 T C 9: 91,364,371 Y216C probably damaging Het
Other mutations in AF366264
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02291:AF366264 APN 8 13837704 missense probably benign 0.03
IGL02647:AF366264 APN 8 13836979 missense probably damaging 0.96
IGL03118:AF366264 APN 8 13838096 utr 5 prime probably benign
FR4342:AF366264 UTSW 8 13837613 missense probably benign 0.00
R0636:AF366264 UTSW 8 13837870 missense probably benign 0.00
R1796:AF366264 UTSW 8 13836816 nonsense probably null
R1913:AF366264 UTSW 8 13837143 missense probably benign 0.16
R2353:AF366264 UTSW 8 13836951 missense probably damaging 1.00
R2944:AF366264 UTSW 8 13837212 missense probably damaging 1.00
R3714:AF366264 UTSW 8 13836736 missense probably benign 0.04
R4222:AF366264 UTSW 8 13838061 missense probably benign
R4628:AF366264 UTSW 8 13836625 missense probably damaging 1.00
R4801:AF366264 UTSW 8 13836970 missense possibly damaging 0.93
R4802:AF366264 UTSW 8 13836970 missense possibly damaging 0.93
R4836:AF366264 UTSW 8 13838007 missense probably benign
R5143:AF366264 UTSW 8 13836844 missense possibly damaging 0.87
R5637:AF366264 UTSW 8 13837713 missense possibly damaging 0.46
R5930:AF366264 UTSW 8 13837263 missense probably benign 0.06
R6540:AF366264 UTSW 8 13837573 missense probably benign 0.07
R6556:AF366264 UTSW 8 13837690 nonsense probably null
R6724:AF366264 UTSW 8 13837083 missense probably damaging 1.00
R7131:AF366264 UTSW 8 13836982 missense probably damaging 0.98
R7148:AF366264 UTSW 8 13837996 missense probably benign 0.01
R7660:AF366264 UTSW 8 13837995 missense probably benign 0.06
R8198:AF366264 UTSW 8 13837056 missense probably benign 0.11
R9090:AF366264 UTSW 8 13836697 missense possibly damaging 0.53
R9271:AF366264 UTSW 8 13836697 missense possibly damaging 0.53
X0020:AF366264 UTSW 8 13836847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTTTGCCCTATTGCTGAAG -3'
(R):5'- AGGAAGCATTCTCAGAACTCC -3'

Sequencing Primer
(F):5'- CCCTATTGCTGAAGCTTCGGG -3'
(R):5'- ACTCCTGAGTTTTCCAGAGTGGAC -3'
Posted On 2021-01-18