Incidental Mutation 'R8483:Nprl3'
ID 657633
Institutional Source Beutler Lab
Gene Symbol Nprl3
Ensembl Gene ENSMUSG00000020289
Gene Name nitrogen permease regulator-like 3
Synonyms Mare, HS-26, Prox1, Phg, -14 gene, HS-40, m(alpha)RE
MMRRC Submission 067927-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.224) question?
Stock # R8483 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 32181963-32217707 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32213083 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 44 (S44C)
Ref Sequence ENSEMBL: ENSMUSP00000120341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020530] [ENSMUST00000109389] [ENSMUST00000124640] [ENSMUST00000129010] [ENSMUST00000136903] [ENSMUST00000137950] [ENSMUST00000141859] [ENSMUST00000149526]
AlphaFold Q8VIJ8
Predicted Effect probably damaging
Transcript: ENSMUST00000020530
AA Change: S44C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020530
Gene: ENSMUSG00000020289
AA Change: S44C

DomainStartEndE-ValueType
Blast:DSPc 1 77 3e-27 BLAST
Pfam:NPR3 104 418 1.8e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109389
AA Change: S44C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105016
Gene: ENSMUSG00000020289
AA Change: S44C

DomainStartEndE-ValueType
Pfam:NPR3 63 108 8.3e-15 PFAM
Pfam:NPR3 104 395 3.1e-80 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124640
AA Change: S44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122085
Gene: ENSMUSG00000020289
AA Change: S44C

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000129010
AA Change: S44C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123219
Gene: ENSMUSG00000020289
AA Change: S44C

DomainStartEndE-ValueType
Blast:DSPc 1 59 3e-29 BLAST
Pfam:NPR3 76 131 3e-16 PFAM
Pfam:NPR3 114 182 3.7e-16 PFAM
Predicted Effect silent
Transcript: ENSMUST00000136903
Predicted Effect probably damaging
Transcript: ENSMUST00000137950
AA Change: S44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115594
Gene: ENSMUSG00000020289
AA Change: S44C

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000141859
AA Change: S44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120341
Gene: ENSMUSG00000020289
AA Change: S44C

DomainStartEndE-ValueType
Blast:DSPc 1 59 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149526
SMART Domains Protein: ENSMUSP00000122231
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Pfam:NPR3 8 72 2.7e-14 PFAM
Meta Mutation Damage Score 0.4442 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of the encoded protein is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: This gene is deleted in the Hbath-J mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang6 A G 14: 44,239,285 (GRCm39) *148Q probably null Het
Ankrd28 A T 14: 31,457,048 (GRCm39) probably null Het
Ark2c G A 18: 77,556,034 (GRCm39) A174V probably benign Het
Aurkc T A 7: 6,999,664 (GRCm39) L57* probably null Het
Brca1 T C 11: 101,416,802 (GRCm39) D444G probably damaging Het
Cd200l1 T A 16: 45,240,235 (GRCm39) I134F possibly damaging Het
Cdhr4 T C 9: 107,872,198 (GRCm39) V204A probably damaging Het
Chd7 A G 4: 8,822,412 (GRCm39) D835G possibly damaging Het
Cux1 C A 5: 136,303,944 (GRCm39) A1328S possibly damaging Het
Cwc27 G T 13: 104,940,772 (GRCm39) P196T probably benign Het
Cwc27 C A 13: 104,940,776 (GRCm39) L194F possibly damaging Het
Cyp39a1 A G 17: 43,993,898 (GRCm39) D186G probably benign Het
Dnah3 T C 7: 119,536,253 (GRCm39) I3677V probably benign Het
Dnmt3b A G 2: 153,516,306 (GRCm39) D477G probably damaging Het
Drc1 A T 5: 30,507,785 (GRCm39) Y269F probably benign Het
Esco2 T C 14: 66,069,118 (GRCm39) H64R probably benign Het
Gcnt3 A T 9: 69,941,959 (GRCm39) V203E probably damaging Het
Gpam A C 19: 55,077,374 (GRCm39) V139G probably damaging Het
Gsta3 G A 1: 21,333,063 (GRCm39) S104N probably damaging Het
Hsd17b13 C T 5: 104,125,049 (GRCm39) G45R probably damaging Het
Ighe T C 12: 113,235,808 (GRCm39) M173V Het
Ipo5 A G 14: 121,183,560 (GRCm39) E1046G probably benign Het
Kank4 T A 4: 98,659,615 (GRCm39) Q821L probably damaging Het
Kat6b G T 14: 21,719,461 (GRCm39) S1271I probably damaging Het
Klhl1 A G 14: 96,619,370 (GRCm39) S176P probably benign Het
Lbhd2 G A 12: 111,378,190 (GRCm39) D86N probably damaging Het
Lrp1 G A 10: 127,394,519 (GRCm39) R2565C probably damaging Het
Lrrc55 A T 2: 85,022,295 (GRCm39) C299S probably benign Het
Mtres1 T C 10: 43,408,915 (GRCm39) Y76C probably benign Het
Nucks1 A G 1: 131,855,829 (GRCm39) H86R possibly damaging Het
Or14j3 A G 17: 37,900,866 (GRCm39) V126A possibly damaging Het
Or4s2 A G 2: 88,473,678 (GRCm39) D189G probably benign Het
Or6c219 T A 10: 129,780,998 (GRCm39) H311L probably benign Het
Ovgp1 T A 3: 105,894,311 (GRCm39) probably benign Het
Oxa1l G A 14: 54,606,001 (GRCm39) probably null Het
Patj C A 4: 98,312,539 (GRCm39) H292Q probably damaging Het
Pcdha9 A G 18: 37,131,636 (GRCm39) N235S probably benign Het
Pcdhb12 A T 18: 37,570,590 (GRCm39) T579S possibly damaging Het
Pde3b A G 7: 114,118,803 (GRCm39) I647M probably benign Het
Pdp1 T C 4: 11,961,982 (GRCm39) R110G probably benign Het
Prb1a T G 6: 132,185,398 (GRCm39) R78S unknown Het
Prmt8 A C 6: 127,680,976 (GRCm39) probably null Het
Semp2l2a T A 8: 13,888,229 (GRCm39) probably benign Het
Slc35f2 T A 9: 53,716,985 (GRCm39) Y249* probably null Het
Smok2b A C 17: 13,453,908 (GRCm39) M23L probably benign Het
Sra1 A G 18: 36,800,879 (GRCm39) I153T probably benign Het
Stk38l T A 6: 146,660,017 (GRCm39) H16Q possibly damaging Het
Tent5c T A 3: 100,379,784 (GRCm39) H324L probably damaging Het
Unc80 T C 1: 66,732,869 (GRCm39) S3073P possibly damaging Het
Usp24 T C 4: 106,230,953 (GRCm39) I844T probably damaging Het
V1ra8 A T 6: 90,179,916 (GRCm39) I40F probably benign Het
Vmn2r88 T A 14: 51,650,530 (GRCm39) M81K possibly damaging Het
Vps8 T C 16: 21,393,763 (GRCm39) I1182T probably damaging Het
Wdr54 A G 6: 83,130,591 (GRCm39) V181A probably benign Het
Zbed4 A G 15: 88,665,990 (GRCm39) Y686C probably damaging Het
Zfyve28 T C 5: 34,393,480 (GRCm39) N62S possibly damaging Het
Zic1 T C 9: 91,246,424 (GRCm39) Y216C probably damaging Het
Other mutations in Nprl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Nprl3 APN 11 32,217,539 (GRCm39) start codon destroyed probably null 0.99
IGL03055:Nprl3 APN 11 32,198,230 (GRCm39) intron probably benign
IGL03366:Nprl3 APN 11 32,200,256 (GRCm39) missense probably damaging 1.00
R0114:Nprl3 UTSW 11 32,189,784 (GRCm39) unclassified probably benign
R0555:Nprl3 UTSW 11 32,183,118 (GRCm39) critical splice acceptor site probably null
R0620:Nprl3 UTSW 11 32,184,876 (GRCm39) missense probably damaging 1.00
R2008:Nprl3 UTSW 11 32,182,973 (GRCm39) missense probably damaging 0.97
R2172:Nprl3 UTSW 11 32,184,894 (GRCm39) missense probably benign 0.00
R2884:Nprl3 UTSW 11 32,198,163 (GRCm39) missense probably damaging 1.00
R3713:Nprl3 UTSW 11 32,205,464 (GRCm39) missense probably damaging 0.98
R3836:Nprl3 UTSW 11 32,183,082 (GRCm39) missense probably damaging 1.00
R4354:Nprl3 UTSW 11 32,184,906 (GRCm39) missense probably benign 0.00
R6052:Nprl3 UTSW 11 32,205,453 (GRCm39) missense possibly damaging 0.92
R6056:Nprl3 UTSW 11 32,217,432 (GRCm39) missense probably damaging 0.98
R6307:Nprl3 UTSW 11 32,189,828 (GRCm39) missense probably damaging 1.00
R6553:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6585:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6774:Nprl3 UTSW 11 32,187,381 (GRCm39) missense probably damaging 1.00
R6806:Nprl3 UTSW 11 32,217,509 (GRCm39) missense probably damaging 0.99
R7746:Nprl3 UTSW 11 32,198,150 (GRCm39) nonsense probably null
R7980:Nprl3 UTSW 11 32,187,357 (GRCm39) missense probably damaging 1.00
R8712:Nprl3 UTSW 11 32,187,334 (GRCm39) missense possibly damaging 0.84
R8827:Nprl3 UTSW 11 32,184,742 (GRCm39) missense probably benign 0.00
R9264:Nprl3 UTSW 11 32,183,948 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCAGATTGCTCAGAGGGAC -3'
(R):5'- TGACACTGAGCTACATGGGTC -3'

Sequencing Primer
(F):5'- TTGCTCAGAGGGACAAACATTTG -3'
(R):5'- TAGCCATGGTTAATGCCCAG -3'
Posted On 2021-01-18