Incidental Mutation 'R8483:Brca1'
ID657634
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Namebreast cancer 1, early onset
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8483 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101488764-101551955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101525976 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 444 (D444G)
Ref Sequence ENSEMBL: ENSMUSP00000017290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]
Predicted Effect probably damaging
Transcript: ENSMUST00000017290
AA Change: D444G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: D444G

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142086
SMART Domains Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
RING 24 64 8.6e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191198
SMART Domains Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
Pfam:EIN3 1 146 3.5e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,919 Y76C probably benign Het
AF366264 T A 8: 13,838,229 probably benign Het
Ang6 A G 14: 44,001,828 *148Q probably null Het
Ankrd28 A T 14: 31,735,091 probably null Het
Aurkc T A 7: 6,996,665 L57* probably null Het
Cdhr4 T C 9: 107,994,999 V204A probably damaging Het
Chd7 A G 4: 8,822,412 D835G possibly damaging Het
Cux1 C A 5: 136,275,090 A1328S possibly damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Cyp39a1 A G 17: 43,683,007 D186G probably benign Het
Dnah3 T C 7: 119,937,030 I3677V probably benign Het
Dnmt3b A G 2: 153,674,386 D477G probably damaging Het
Drc1 A T 5: 30,350,441 Y269F probably benign Het
Esco2 T C 14: 65,831,669 H64R probably benign Het
Fam46c T A 3: 100,472,468 H324L probably damaging Het
Gcnt3 A T 9: 70,034,677 V203E probably damaging Het
Gm609 T A 16: 45,419,872 I134F possibly damaging Het
Gpam A C 19: 55,088,942 V139G probably damaging Het
Gsta3 G A 1: 21,262,839 S104N probably damaging Het
Hsd17b13 C T 5: 103,977,183 G45R probably damaging Het
Ighe T C 12: 113,272,188 M173V Het
Ipo5 A G 14: 120,946,148 E1046G probably benign Het
Kank4 T A 4: 98,771,378 Q821L probably damaging Het
Kat6b G T 14: 21,669,393 S1271I probably damaging Het
Klhl1 A G 14: 96,381,934 S176P probably benign Het
Lbhd2 G A 12: 111,411,756 D86N probably damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Lrrc55 A T 2: 85,191,951 C299S probably benign Het
Nprl3 T A 11: 32,263,083 S44C probably damaging Het
Nucks1 A G 1: 131,928,091 H86R possibly damaging Het
Olfr114 A G 17: 37,589,975 V126A possibly damaging Het
Olfr1191-ps1 A G 2: 88,643,334 D189G probably benign Het
Olfr818 T A 10: 129,945,129 H311L probably benign Het
Ovgp1 T A 3: 105,986,995 probably benign Het
Oxa1l G A 14: 54,368,544 probably null Het
Patj C A 4: 98,424,302 H292Q probably damaging Het
Pcdha9 A G 18: 36,998,583 N235S probably benign Het
Pcdhb12 A T 18: 37,437,537 T579S possibly damaging Het
Pde3b A G 7: 114,519,568 I647M probably benign Het
Pdp1 T C 4: 11,961,982 R110G probably benign Het
Prb1 T G 6: 132,208,435 R78S unknown Het
Prmt8 A C 6: 127,704,013 probably null Het
Rnf165 G A 18: 77,468,338 A174V probably benign Het
Slc35f2 T A 9: 53,809,701 Y249* probably null Het
Smok2b A C 17: 13,235,021 M23L probably benign Het
Sra1 A G 18: 36,667,826 I153T probably benign Het
Stk38l T A 6: 146,758,519 H16Q possibly damaging Het
Unc80 T C 1: 66,693,710 S3073P possibly damaging Het
Usp24 T C 4: 106,373,756 I844T probably damaging Het
V1ra8 A T 6: 90,202,934 I40F probably benign Het
Vmn2r88 T A 14: 51,413,073 M81K possibly damaging Het
Vps8 T C 16: 21,575,013 I1182T probably damaging Het
Wdr54 A G 6: 83,153,610 V181A probably benign Het
Zbed4 A G 15: 88,781,787 Y686C probably damaging Het
Zfyve28 T C 5: 34,236,136 N62S possibly damaging Het
Zic1 T C 9: 91,364,371 Y216C probably damaging Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
BB002:Brca1 UTSW 11 101508146 missense probably benign 0.01
BB009:Brca1 UTSW 11 101540017 missense possibly damaging 0.85
BB012:Brca1 UTSW 11 101508146 missense probably benign 0.01
BB019:Brca1 UTSW 11 101540017 missense possibly damaging 0.85
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101525366 missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1687:Brca1 UTSW 11 101489840 missense probably benign
R1694:Brca1 UTSW 11 101532099 missense probably damaging 0.98
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R2106:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R4089:Brca1 UTSW 11 101524176 missense possibly damaging 0.73
R4194:Brca1 UTSW 11 101525287 missense probably benign 0.02
R4571:Brca1 UTSW 11 101517366 missense probably benign 0.00
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5458:Brca1 UTSW 11 101517285 missense possibly damaging 0.53
R5778:Brca1 UTSW 11 101525301 missense possibly damaging 0.47
R6051:Brca1 UTSW 11 101524246 missense probably damaging 1.00
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7246:Brca1 UTSW 11 101523378 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
R7861:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R7925:Brca1 UTSW 11 101508146 missense probably benign 0.01
R7932:Brca1 UTSW 11 101540017 missense possibly damaging 0.85
R8003:Brca1 UTSW 11 101524477 missense probably benign 0.22
R8046:Brca1 UTSW 11 101525470 missense probably benign 0.03
R8306:Brca1 UTSW 11 101525637 missense probably damaging 1.00
R8685:Brca1 UTSW 11 101489846 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GTCCTTTGAACACCTGCTGAATC -3'
(R):5'- AAATGTTAACTTCTGACAGCGC -3'

Sequencing Primer
(F):5'- CCTCAGGTTGAAGGGATGTAC -3'
(R):5'- AACTTCTGACAGCGCATCTGC -3'
Posted On2021-01-18