Incidental Mutation 'R8483:Cyp39a1'
ID 657649
Institutional Source Beutler Lab
Gene Symbol Cyp39a1
Ensembl Gene ENSMUSG00000023963
Gene Name cytochrome P450, family 39, subfamily a, polypeptide 1
Synonyms oxysterol 7-alpha-hydroxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R8483 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 43667425-43751431 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43683007 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 186 (D186G)
Ref Sequence ENSEMBL: ENSMUSP00000130073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170988]
AlphaFold Q9JKJ9
Predicted Effect probably benign
Transcript: ENSMUST00000170988
AA Change: D186G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000130073
Gene: ENSMUSG00000023963
AA Change: D186G

DomainStartEndE-ValueType
Pfam:p450 32 464 1.9e-52 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein is involved in the conversion of cholesterol to bile acids. Its substrates include the oxysterols 25-hydroxycholesterol, 27-hydroxycholesterol and 24-hydroxycholesterol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,919 Y76C probably benign Het
AF366264 T A 8: 13,838,229 probably benign Het
Ang6 A G 14: 44,001,828 *148Q probably null Het
Ankrd28 A T 14: 31,735,091 probably null Het
Aurkc T A 7: 6,996,665 L57* probably null Het
Brca1 T C 11: 101,525,976 D444G probably damaging Het
Cdhr4 T C 9: 107,994,999 V204A probably damaging Het
Chd7 A G 4: 8,822,412 D835G possibly damaging Het
Cux1 C A 5: 136,275,090 A1328S possibly damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Dnah3 T C 7: 119,937,030 I3677V probably benign Het
Dnmt3b A G 2: 153,674,386 D477G probably damaging Het
Drc1 A T 5: 30,350,441 Y269F probably benign Het
Esco2 T C 14: 65,831,669 H64R probably benign Het
Fam46c T A 3: 100,472,468 H324L probably damaging Het
Gcnt3 A T 9: 70,034,677 V203E probably damaging Het
Gm609 T A 16: 45,419,872 I134F possibly damaging Het
Gpam A C 19: 55,088,942 V139G probably damaging Het
Gsta3 G A 1: 21,262,839 S104N probably damaging Het
Hsd17b13 C T 5: 103,977,183 G45R probably damaging Het
Ighe T C 12: 113,272,188 M173V Het
Ipo5 A G 14: 120,946,148 E1046G probably benign Het
Kank4 T A 4: 98,771,378 Q821L probably damaging Het
Kat6b G T 14: 21,669,393 S1271I probably damaging Het
Klhl1 A G 14: 96,381,934 S176P probably benign Het
Lbhd2 G A 12: 111,411,756 D86N probably damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Lrrc55 A T 2: 85,191,951 C299S probably benign Het
Nprl3 T A 11: 32,263,083 S44C probably damaging Het
Nucks1 A G 1: 131,928,091 H86R possibly damaging Het
Olfr114 A G 17: 37,589,975 V126A possibly damaging Het
Olfr1191-ps1 A G 2: 88,643,334 D189G probably benign Het
Olfr818 T A 10: 129,945,129 H311L probably benign Het
Ovgp1 T A 3: 105,986,995 probably benign Het
Oxa1l G A 14: 54,368,544 probably null Het
Patj C A 4: 98,424,302 H292Q probably damaging Het
Pcdha9 A G 18: 36,998,583 N235S probably benign Het
Pcdhb12 A T 18: 37,437,537 T579S possibly damaging Het
Pde3b A G 7: 114,519,568 I647M probably benign Het
Pdp1 T C 4: 11,961,982 R110G probably benign Het
Prb1 T G 6: 132,208,435 R78S unknown Het
Prmt8 A C 6: 127,704,013 probably null Het
Rnf165 G A 18: 77,468,338 A174V probably benign Het
Slc35f2 T A 9: 53,809,701 Y249* probably null Het
Smok2b A C 17: 13,235,021 M23L probably benign Het
Sra1 A G 18: 36,667,826 I153T probably benign Het
Stk38l T A 6: 146,758,519 H16Q possibly damaging Het
Unc80 T C 1: 66,693,710 S3073P possibly damaging Het
Usp24 T C 4: 106,373,756 I844T probably damaging Het
V1ra8 A T 6: 90,202,934 I40F probably benign Het
Vmn2r88 T A 14: 51,413,073 M81K possibly damaging Het
Vps8 T C 16: 21,575,013 I1182T probably damaging Het
Wdr54 A G 6: 83,153,610 V181A probably benign Het
Zbed4 A G 15: 88,781,787 Y686C probably damaging Het
Zfyve28 T C 5: 34,236,136 N62S possibly damaging Het
Zic1 T C 9: 91,364,371 Y216C probably damaging Het
Other mutations in Cyp39a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Cyp39a1 APN 17 43701543 missense probably benign 0.01
IGL01070:Cyp39a1 APN 17 43683022 missense probably benign 0.00
IGL01606:Cyp39a1 APN 17 43746618 splice site probably benign
IGL01769:Cyp39a1 APN 17 43749915 missense possibly damaging 0.53
IGL01916:Cyp39a1 APN 17 43731050 missense probably damaging 1.00
IGL02374:Cyp39a1 APN 17 43749981 utr 3 prime probably benign
IGL02402:Cyp39a1 APN 17 43691722 missense probably benign 0.07
IGL03097:Cyp39a1 UTSW 17 43683050 nonsense probably null
R0230:Cyp39a1 UTSW 17 43732012 missense probably damaging 1.00
R1244:Cyp39a1 UTSW 17 43749945 missense probably benign 0.13
R1572:Cyp39a1 UTSW 17 43680129 missense probably damaging 1.00
R1656:Cyp39a1 UTSW 17 43667619 missense possibly damaging 0.74
R4036:Cyp39a1 UTSW 17 43676940 missense probably damaging 0.97
R4308:Cyp39a1 UTSW 17 43730964 splice site probably null
R5081:Cyp39a1 UTSW 17 43746597 missense probably damaging 1.00
R5197:Cyp39a1 UTSW 17 43746538 missense possibly damaging 0.67
R5405:Cyp39a1 UTSW 17 43676940 missense probably damaging 1.00
R5566:Cyp39a1 UTSW 17 43685208 missense possibly damaging 0.92
R5578:Cyp39a1 UTSW 17 43680140 missense possibly damaging 0.91
R6045:Cyp39a1 UTSW 17 43731991 missense probably damaging 1.00
R6495:Cyp39a1 UTSW 17 43691694 missense probably benign 0.41
R7191:Cyp39a1 UTSW 17 43731019 nonsense probably null
R7431:Cyp39a1 UTSW 17 43683015 missense probably benign
R7522:Cyp39a1 UTSW 17 43667479 start gained probably benign
R7620:Cyp39a1 UTSW 17 43725653 splice site probably null
R8022:Cyp39a1 UTSW 17 43746577 missense probably damaging 1.00
R8143:Cyp39a1 UTSW 17 43725626 missense probably benign 0.39
R8549:Cyp39a1 UTSW 17 43730995 missense possibly damaging 0.95
R8964:Cyp39a1 UTSW 17 43691667 missense probably benign 0.02
R9730:Cyp39a1 UTSW 17 43680138 missense probably benign 0.01
Z1176:Cyp39a1 UTSW 17 43725577 missense probably benign 0.01
Z1176:Cyp39a1 UTSW 17 43731048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAATGCTGCCTTTGTATCTAG -3'
(R):5'- CGGCAAGTGCAGTATATCCCC -3'

Sequencing Primer
(F):5'- GTATCTAGAGCAGTGTTCTCAACC -3'
(R):5'- GTGCAAGCTTAAAGACCTGTGCTC -3'
Posted On 2021-01-18