Incidental Mutation 'R8485:Dnah7c'
ID 657657
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Name dynein, axonemal, heavy chain 7C
Synonyms Dnahc7c
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R8485 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 46425592-46807476 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 46680792 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 2801 (D2801A)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000189749
AA Change: D2801A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: D2801A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 A G 3: 97,158,986 probably benign Het
Adamts16 T C 13: 70,738,675 T999A possibly damaging Het
Adgrb1 A C 15: 74,548,304 T829P probably damaging Het
Ankrd12 C T 17: 65,983,716 S1574N probably benign Het
Ankrd2 G A 19: 42,041,945 probably null Het
Ano3 T A 2: 110,667,855 probably null Het
Arhgap18 T C 10: 26,846,108 I25T probably benign Het
Armc3 T C 2: 19,293,134 F572S probably damaging Het
Aspdh G T 7: 44,467,669 G165W probably damaging Het
Btnl10 G T 11: 58,920,316 R155L possibly damaging Het
Cacng7 A G 7: 3,366,025 E168G probably benign Het
Cadps G A 14: 12,439,872 T1215M probably damaging Het
Cbfa2t3 C A 8: 122,630,778 G598C probably damaging Het
Cdh15 T C 8: 122,857,366 S69P probably damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Dlec1 T G 9: 119,128,591 V881G probably benign Het
Efhc1 T C 1: 20,960,236 M131T possibly damaging Het
Ercc2 G A 7: 19,388,240 V386I possibly damaging Het
Exoc4 T A 6: 33,921,501 I885N probably damaging Het
Fbxl22 C T 9: 66,514,567 probably null Het
Flii G T 11: 60,716,237 A971E probably benign Het
Fnip2 T A 3: 79,481,537 E599V probably benign Het
Glb1l2 G A 9: 26,767,740 L453F probably benign Het
Gm49368 C T 7: 128,112,439 P624L probably damaging Het
Gpa33 T A 1: 166,164,692 D268E probably benign Het
Gpi1 A T 7: 34,219,252 probably null Het
Iqgap2 T C 13: 95,660,151 N1165S probably damaging Het
Kctd2 G T 11: 115,429,608 probably benign Het
L1td1 C T 4: 98,737,674 A702V probably damaging Het
Lrmp A T 6: 145,171,674 N379I probably damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Mycbpap A G 11: 94,511,708 L267P probably damaging Het
Mycbpap T C 11: 94,514,533 R57G probably benign Het
Myo1b A C 1: 51,779,601 L505R probably damaging Het
Nfatc2 A C 2: 168,590,092 F34V probably damaging Het
Nphs1 A G 7: 30,466,173 N655S probably damaging Het
Nsd2 A T 5: 33,882,845 I909F probably damaging Het
Olfr1130 A T 2: 87,608,257 M290L probably benign Het
Olfr884 T A 9: 38,047,957 M245K probably benign Het
Pak2 G A 16: 32,052,265 A33V probably benign Het
Phb A G 11: 95,675,229 D113G probably benign Het
Pkhd1 T A 1: 20,523,033 I1619F probably damaging Het
Pkhd1l1 A G 15: 44,560,400 I3113V probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Prrc2b T A 2: 32,212,093 M726K possibly damaging Het
Rai14 A G 15: 10,575,036 L612P probably damaging Het
Rapgef1 T C 2: 29,710,174 S598P probably damaging Het
Rdm1 G A 11: 101,627,990 V8I probably benign Het
Rrbp1 A G 2: 143,955,013 F1148L probably benign Het
Slc12a2 T C 18: 57,941,146 probably null Het
Slc7a8 T A 14: 54,724,807 T457S probably benign Het
Stk32a T A 18: 43,243,010 M48K possibly damaging Het
Svil T C 18: 5,064,566 S642P probably benign Het
Taok3 G A 5: 117,251,077 V516M possibly damaging Het
Ugdh T C 5: 65,427,559 I7V possibly damaging Het
Zc3h11a T A 1: 133,625,895 S504C possibly damaging Het
Zfp512 C T 5: 31,480,057 R497W probably damaging Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46760361 splice site probably null
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46615367 missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46639665 missense probably benign 0.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5933:Dnah7c UTSW 1 46519215 missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7131:Dnah7c UTSW 1 46681772 missense probably benign 0.00
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46666063 missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46647036 missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46457290 missense probably benign
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
R7605:Dnah7c UTSW 1 46632310 missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46602813 missense probably benign
R7770:Dnah7c UTSW 1 46626300 splice site probably null
R7884:Dnah7c UTSW 1 46791769 missense probably benign 0.23
R7899:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R8025:Dnah7c UTSW 1 46457296 missense probably benign 0.01
R8057:Dnah7c UTSW 1 46688952 missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46607458 missense possibly damaging 0.56
R8255:Dnah7c UTSW 1 46659429 missense probably damaging 1.00
R8428:Dnah7c UTSW 1 46672376 missense probably damaging 1.00
R8441:Dnah7c UTSW 1 46533238 missense probably damaging 1.00
R8559:Dnah7c UTSW 1 46725139 missense probably damaging 1.00
R8752:Dnah7c UTSW 1 46672541 missense probably benign 0.00
R8869:Dnah7c UTSW 1 46632344 missense probably damaging 0.97
R9058:Dnah7c UTSW 1 46766656 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46665490 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46777736 missense probably benign 0.00
R9246:Dnah7c UTSW 1 46532774 missense possibly damaging 0.51
R9319:Dnah7c UTSW 1 46482008 missense possibly damaging 0.94
R9388:Dnah7c UTSW 1 46740726 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46467302 missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46615281 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46639665 missense probably benign
Z1176:Dnah7c UTSW 1 46646992 critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46760316 missense possibly damaging 0.95
Z1177:Dnah7c UTSW 1 46654103 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTCGGTGACATAAGGTTTCTGC -3'
(R):5'- GCTTTGGGGAGACTTTAGAAATAC -3'

Sequencing Primer
(F):5'- TGCAGTCACTTCATGAGTACGAC -3'
(R):5'- TCCTAACTCCCAAAACTTTAATGATC -3'
Posted On 2021-01-18