Incidental Mutation 'R8485:Ano3'
ID 657665
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Name anoctamin 3
Synonyms Tmem16c, B230324K02Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R8485 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 110655201-110950923 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 110667855 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
AlphaFold A2AHL1
Predicted Effect probably null
Transcript: ENSMUST00000099623
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Meta Mutation Damage Score 0.9490 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 A G 3: 97,158,986 probably benign Het
Adamts16 T C 13: 70,738,675 T999A possibly damaging Het
Adgrb1 A C 15: 74,548,304 T829P probably damaging Het
Ankrd12 C T 17: 65,983,716 S1574N probably benign Het
Ankrd2 G A 19: 42,041,945 probably null Het
Arhgap18 T C 10: 26,846,108 I25T probably benign Het
Armc3 T C 2: 19,293,134 F572S probably damaging Het
Aspdh G T 7: 44,467,669 G165W probably damaging Het
Btnl10 G T 11: 58,920,316 R155L possibly damaging Het
Cacng7 A G 7: 3,366,025 E168G probably benign Het
Cadps G A 14: 12,439,872 T1215M probably damaging Het
Cbfa2t3 C A 8: 122,630,778 G598C probably damaging Het
Cdh15 T C 8: 122,857,366 S69P probably damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Dlec1 T G 9: 119,128,591 V881G probably benign Het
Dnah7c A C 1: 46,680,792 D2801A probably benign Het
Efhc1 T C 1: 20,960,236 M131T possibly damaging Het
Ercc2 G A 7: 19,388,240 V386I possibly damaging Het
Exoc4 T A 6: 33,921,501 I885N probably damaging Het
Fbxl22 C T 9: 66,514,567 probably null Het
Flii G T 11: 60,716,237 A971E probably benign Het
Fnip2 T A 3: 79,481,537 E599V probably benign Het
Glb1l2 G A 9: 26,767,740 L453F probably benign Het
Gm49368 C T 7: 128,112,439 P624L probably damaging Het
Gpa33 T A 1: 166,164,692 D268E probably benign Het
Gpi1 A T 7: 34,219,252 probably null Het
Iqgap2 T C 13: 95,660,151 N1165S probably damaging Het
Kctd2 G T 11: 115,429,608 probably benign Het
L1td1 C T 4: 98,737,674 A702V probably damaging Het
Lrmp A T 6: 145,171,674 N379I probably damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Mycbpap A G 11: 94,511,708 L267P probably damaging Het
Mycbpap T C 11: 94,514,533 R57G probably benign Het
Myo1b A C 1: 51,779,601 L505R probably damaging Het
Nfatc2 A C 2: 168,590,092 F34V probably damaging Het
Nphs1 A G 7: 30,466,173 N655S probably damaging Het
Nsd2 A T 5: 33,882,845 I909F probably damaging Het
Olfr1130 A T 2: 87,608,257 M290L probably benign Het
Olfr884 T A 9: 38,047,957 M245K probably benign Het
Pak2 G A 16: 32,052,265 A33V probably benign Het
Phb A G 11: 95,675,229 D113G probably benign Het
Pkhd1 T A 1: 20,523,033 I1619F probably damaging Het
Pkhd1l1 A G 15: 44,560,400 I3113V probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Prrc2b T A 2: 32,212,093 M726K possibly damaging Het
Rai14 A G 15: 10,575,036 L612P probably damaging Het
Rapgef1 T C 2: 29,710,174 S598P probably damaging Het
Rdm1 G A 11: 101,627,990 V8I probably benign Het
Rrbp1 A G 2: 143,955,013 F1148L probably benign Het
Slc12a2 T C 18: 57,941,146 probably null Het
Slc7a8 T A 14: 54,724,807 T457S probably benign Het
Stk32a T A 18: 43,243,010 M48K possibly damaging Het
Svil T C 18: 5,064,566 S642P probably benign Het
Taok3 G A 5: 117,251,077 V516M possibly damaging Het
Ugdh T C 5: 65,427,559 I7V possibly damaging Het
Zc3h11a T A 1: 133,625,895 S504C possibly damaging Het
Zfp512 C T 5: 31,480,057 R497W probably damaging Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 splice site probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 splice site probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
R7888:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R7992:Ano3 UTSW 2 110775022 missense possibly damaging 0.77
R8024:Ano3 UTSW 2 110667783 missense probably damaging 0.99
R8074:Ano3 UTSW 2 110950232 start gained probably benign
R8111:Ano3 UTSW 2 110783713 missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110666456 missense probably damaging 1.00
R8297:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R8509:Ano3 UTSW 2 110665835 missense possibly damaging 0.50
R8870:Ano3 UTSW 2 110783729 missense probably benign 0.12
R9071:Ano3 UTSW 2 110795073 critical splice acceptor site probably null
R9072:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9073:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9315:Ano3 UTSW 2 110697942 missense probably damaging 0.97
R9376:Ano3 UTSW 2 110666437 missense probably damaging 1.00
R9588:Ano3 UTSW 2 110697997 missense not run
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110697036 missense probably benign 0.30
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGGCCAAATGGTCCTG -3'
(R):5'- GGCCTTAGAAAGCGCTAAAATG -3'

Sequencing Primer
(F):5'- ATGGTCCTGCAGAAAGTCTC -3'
(R):5'- GCCTTAGAAAGCGCTAAAATGATAAG -3'
Posted On 2021-01-18